Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig81
Contig Information
Length 910 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6h08    rwhok6h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14085 [Oryza sativa Indica Group]
Score 1138
Evalue 1.36253e-122
Total Hit Count 413
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig81
AGCCGAAGATGGCTGGGATTGATCCTGATGATGTTTACTCAGAAGTGCCCTATGAGAAAGGCTTCCAGTTCCTTTGGCGCATCGAACGCCAGATTGGCCG
ACCTGCATTCGATGAATTCCTCAAGAAGTATATTGCCAACTTCAAGTTCCAATCGATAGATACAGAGACATTTCTTGAATTCCTGAGAGCCAATGTACCT
GGGATTGAAAATCAAGTTGACCTTCATGAGTGGATCAATGGTACTGGTCTCCCTCCGGATGCCATGGAGCCAGAATCAGCTACCTATAAGAAGATTTGTG
TCTTAGCTGCAGAGTTTAAGTCTGGAAAAATTCCAAGTGAAGAGGAGGTGGCAGACTGGAGTGGACAAGAATGGGAGCTTTACTTGGAAAATTTACCCAC
AGATGTTGAAGCATCACAGGTTACTGCTCTTGATGAACGGTACAAGCTGTCAGAAAGCCGCGACTACGAGGTCAAAGTCGCATTCCTCCAGCTAGCGATC
CCCACGGGCTGCAGGTGTTACTTCAACGAGGTGGAGAAATGCTTGAAGCAGGTGGGGAGGATGAAGTACCTGCGCCCGCTCTACAGCTCGCTGGCTCGGT
GCTCAGGGGAGGAAGAGAAGATGCTGGCCAAGAGGATCTTCTCGGAGGCCCAAGAGTTCTACCACCCGATAGCCCGCGGCGTCGCGGAGAGCATCCTTTT
GAAGCATGGCTAGTTGAGTTGAAGCCACATTTTACCGAGCCTGAACTAGAGAGAACATCTTTGATGCCTATTGACTGTTTGCTCGCTCATTTCTTCCGCA
TAAATTTATCTCTAGAGCTGACCTTGGATGAAACACTGAACTTCCTTCCGTGATGTGTTATGTGAGACTGCATGTGCGTAATTTATTCTGACCCTGTAAG
GAACTGAAAC
page-top