Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig80
Contig Information
Length 913 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6h13    rwhok6h13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit uncoupling protein [Triticum aestivum]
Score 965
Evalue 8.88345e-126
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig80
GAATGCTGGGCACAATGATGTCGATTGCAAGGGAGGAAGGCGTCAGCGCACTTTGGAAGGGCATCNTCCCTGGCTTTCACCGCCAGTGCCTCTATGGCGG
CCTCCGTGTCGGCTTGTATGAGCCTGTCAAAGCCTTATTTGTGTTTTGTAGGTGATGCCACTTTAATGAACAAGATTCTTGCCGCTCTTACAACTGGTGT
CATAGCGATTGCTGTCGCAAATCCAACTGATCTTGTCAAAGTGAGATTGCAAGCAGATGGAAAATCTACTGCTGTCAAGAGGCACTATTCTGGAGCCCTT
AATGCGTATGCCACCATAGTCAGACAGGAAGGTATCGGAGCTTTGTGGACTGGCCTTGGTCCTAATATGGCACGAAATGCTTTGATTAATGCCGCCGAGT
TGGCCAGCTATGACCAATTTAAACAGATGTTTCTAGGTCTTCCTGGGTTTACAGATAATGTTTATACTCATCTTTTGGCTGGACTCGGTGCCGGTATTTT
TGCTGTTTGCATTGGATCTCCAGTGGATGTGGTGAAATCAAGAATGATGGGCGATTCAACATACAGAAGTACATTTGATTGTTTCGCCAAGACATTAAAA
AATGATGGACTTGCTGCTTTCTACAAGGGGTTTATTGCAAACTTTTGTCGAGTTGGGTCATGGAATGTCATAATGTTCTTANCTTTGGAACAGGTTAGAA
GATTCTTTCAGTAAGGATTATATATGAACTCTGCGCTGCAAGGTTTCATGGAACAAGCTGGGTACAGCTTCTGGAGCAACAGACATACACAATCATTCAG
CATAGGATTCAGATTTTCATTGTACAGGAGAATGCATTCCTCATGTTGTAATTTGATCTATTTGATGACTACGACTGAGCATGTTGTTACGCTTTTACCC
GATGCCCGCTTAC
page-top