Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig79
Contig Information
Length 1004 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6h16    rwhok6h16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_36411 [Oryza sativa Indica Group]
Score 712
Evalue 4.01182e-73
Total Hit Count 349
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig79
AAAAGGTAGACTACGATTGCCGGCATCGAGCTCGACGAGGCGTCGGAGTTGCGACAAAGATGAGGAAGAAGCTGGGCACCCGGTTCCCCGCGGCACGGAT
CAAAAAGATAATGCAAGCAGATGAGGATGTTGGCAAAATTGCACTGGCTGTGCCTGTTTTAGTTTCGAGAGCCCTTGAATTGTTTCTGCAAGATTTGATT
GACCCGCTCATACAAAATTACTCTTCAAAGTGGTGCAAAGACACTGAATTCCTTCCACCTAAAGCAATGTGTGAAGAGGTACAGCTCTTTTGACTTCCTA
ACTGAGATTGTCAACAAGGTGCCAGATCTCGGTGGCGGTGAATCTTGTGGAGATGAAAGAGGATTACCCAGAAGAAGGAAATTTTCAAATGGAAGCGACC
CAGAGAATGAGGAGCCCCGATCTAGCAAAATGCCCATAAGAAGCTTGAACACTAGTCCCAGAGGACGAGGCAGAGGTCGAGGAAGAGGGCGAGGGCGGCC
TCCAACCAAGAGAAAGGAAATTGGTTATGTACAGTTTGAGGATGAGAGCAGCATGTTTGCTGAACAAAGTGAACCCTTGCCAGGAGATGAGATAGTTCCA
GAGACCAACCGTGGCAATGAGATTATTCCCCAAAGCTCACATCCTCTAGTGGAGGCTCCATCGGTCGTGACGCCAGCTGTGATTTCAAAGGTTGAAAAAG
CCACCAACCATCAGCCAGATTTGCCTATGCCAGATGCCATTGGAGGCATTGGTGTTGGACCGTCCAGTTTTGGACATCTGACAGTGCAGGTTGATGAGGA
AGAGGACTACGATAATGAGGATTAGGCATAGCCATCCTCTCATTCATCATATGCTCTAACAGGACAGTTCTCCTGGTGTTGTACATTGTAAATATTGTTT
CAAGTAGTTACCGCAGCTATGATGTGTAACCTATTTCTTTTTCCCAATAATTGGTTTCGAGTTGCCTCGCATTGTTGACTTAACTGACTAGGATGTGCTA
AACT
page-top