Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig78
Contig Information
Length 1006 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6l04    rwhok6l04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11345 [Oryza sativa Indica Group]
Score 617
Evalue 4.18213e-62
Total Hit Count 429
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig78
CCGCCGGCTTTCCCCATTCTTCCCAGGTCGCCGAGTCAACATCCGTCACCGGCGGCAGAACCACCCTGCGCACCTACCCCCGTTCCCCCAAAACCCAGGT
ACCCAGGCTTTCCCTCTGCGAGCCCCCCGAGCCCTAAGCTCCAGCGAGCCCCTATGGCGGCGCAGGAGATCAAGGACGCCGTGCAGGCTTACACGGGCCT
CTCACCCGCGGCCGCCTTCACCGTGCTGGCTCTCATGCTCGCCACCTACCTCATCGTCTCCACCCTCTTCGTCGCCCCAGACGCCGCCGCTTCCGCACCG
GCGGCTCATCCCCAGCCGCCTCAGCAGCAGAAGCAGGTGACGGAGGCGGAGGCGGAGGCGGAGGAGCCGTTCGTGCCGCTGTTTCCGGACCCTGTGCAGG
TGGGCGAGATCACGCTCGAGCAGCTCAGGGCGTATGACGGCAAGGATCCAGCCAAGTCCATCCTCATCGCCATCCGCGGTCAGGTCTACGACGTCTCGCG
CGGGAGGCTGTTTTATGGACCTCAAGGACCATACTCCTTGTTTGCCGGGAGGGATGCATCTCGGGCCCTGGCATTGATGTCATTTGACCTTAATGACCTG
ACTGGAGACTTGGAAGGCCTGAGCCCAGACGAACTGGAGGTTTTACAAGACTGGGAAGAGAAGTTTAAAGAGAGGTACCCTGTGGTGGGCCATCTTCCTT
GTGAGAAAGGCAACAGCTGATGCTCAGCCTGATCACGAGGAAGAGAAGGCCTAACTCTGTGTCTGGGTTCTTGTCTCGTTGCCTGTAAGTTCTTGTGTCT
TTTACTACTGGACTGCGAGCGGTAGAGAGATCTAATGCGCTGACAGGTGATGTTGTTTGTATGTGTGCTGCATGAGTGTGTGTGACTAATGCACCTGCTT
TACTACTACTACTTTGGTTGGTGTGTGTCAGTGTGTGGGAGGAATTTTGAGTGACAGAGAAACCTTGGCGCTGAAAGGCCGTGCTTTAGATTCGTGCCAA
ATCCAT
page-top