Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig77
Contig Information
Length 1126 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6h18    rwhok6h18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0822300 [Oryza sativa (japonica cultivar-group)] >gi|108711810|gb|ABF99605.1| FtsJ-like methyltransferase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550205|dbj|BAF13648.1| Os03g0822300 [Oryza sativa (japonica cultivar-group)] >gi|218194004|gb|EEC76431.1| hypothetical protein OsI_14112 [Oryza sativa Indica Group]
Score 706
Evalue 7.60014e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig77
GCCGTCCGTTCTCCGCTCGCCGCCGCGCCGCAATATCGTCGGGAACATGAGCGGCGCGACGGGCACCGCCGACTTCTTCTACCGGGAGGCGCTGCGCCTC
GGCTACGTCGCCCGCTCTGCCTTCAAGCTGATCCAGATACAGAAGCAGCACAAGCTCATCGCCCCGGGCGCCGCCGTGCTCGACCTCGGGTGCGCCCCCG
GCGCGTGGCTCCAGGTGGCCTGCCAGAACCTTGGCCCGCTCGAGAAGGGCGGCCTGGTCGTCGGCGTCGATGTCAAGAGCAGAAGGTGAAGGTCCCCTCA
GCGCACTGCGACTCGCGGGTCAGGACGGTCTGCACCGATGTGATGGCTTTGATGAAGCAGCAAGCCAGGGCGATGTCGCCGCAGGAACGGGGATTTTCTG
TGATATTATCCGACATGTGTCCGGTAGTTTCAGGGATCACAACCAGAGACGAAGCTATATCTTGTGAGCTGGGCATGCGTGCGCTCTCGTTGGCAGTTGG
TAAGATAAAGGTCAAAGAATCGGCCGACTATCGTGAGACTATGGAGAGGTTTCAGAGCTCCACAGGCCCAGATCCTGATGAGGACGGTGTTCTTAGACGT
GGAGGCAGCCTAGTAATCAAGTTTCTTGAGAACGAGGATATACCAGGGTTTAACAAATTTTGCAAAGAGAAGTTTAAGAAAGTATCTCTCCTGAGGCCTA
AGGCGACGAGGTCTAGTTCGAGGGAGATCTACATGATCTGCGAAGGGTTGCGGTAGAAGATTGGCCACCACTCACCTCCCATGAGATCTTGCAAGCTTGT
GCTGAGCAGAGTGGCTGGACCAAGAACTCTACAAATTTGCCGGTGAGCTGTAGGCGTGTAGGCCTGAGATGATGCTAACTTCATCGGCAATTCATGATTA
CTGAGTTGAGGAAACTCCGATGGTATCTCTCCTGGAGGTGATTTGGTTTGGTGCCTTTGTTAAAGAACAGCCGTATTGGCTTTGCGTTCGTGCTTTTAGA
AGAAAAAAGGTTGTACCTGTCTTGATAACCGTGTTGATTCGTCTCTAACCTGTGTGCTGTATCATCTGTCTTCCAAGGCATCGTGTTTTAATATCATTTC
TTAGCGAATTTGCTACAGTACATATT
page-top