Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig76
Contig Information
Length 786 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6m22    whok7k19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0316900 [Oryza sativa (japonica cultivar-group)] >gi|108707829|gb|ABF95624.1| ABC transporter family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548411|dbj|BAF11854.1| Os03g0316900 [Oryza sativa (japonica cultivar-group)] >gi|215697238|dbj|BAG91232.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192699|gb|EEC75126.1| hypothetical protein OsI_11311 [Oryza sativa Indica Group]
Score 822
Evalue 4.67073e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig76
GATATACAGATGGACATTTCGGCAGAGAAGATGCTATTTGGTGTCACTGGCGTTGATCCTCAGAGAAGAGATGAGCTTATCAAGATTTTGGATGTTGACC
TTACCTGGCGGATGCACAAGGCATCAGATGGTCAGAGGAGAAGAGTCCAGATTTGCATGGGACTTCTCAAGCCATTCAAGGTTCTTCTTCTTGATGAGAT
AACAGTTGATCTTGATGTGTTGGCAAGAGCAAATCTGTTGACATATCTAAAGAAGGAATGTGCGGAACAAGGTGCAACAATTATCTATGCCACACATATC
TTCGATGGCCTGGATGACTGGCCAACTCACATTGTCTATGTTGCTCATGGGAAGTTGCAACTAGCGCTGCCATTAGAAAAGGTGAAAGAAATGAGCCAGT
TATCGCTCATGAGAACAGTAGAGCGCTGGCTGAGGAAAGAGAGGGACGAAGACAGGAGGAAGAGAAAGGAACGGAAGGAGAAAGGCCTCCCGGCATTCGA
CAAGGTCATTGAGGGGAGCAGAGTAGTGAACAACGGGTGGGCAGCAGGAAGGCTCACTTCGACGATAGCCGGGGAAGAGAACTTTTCTCTCAGTTCAAAC
AGCGTTCTTCGGTAGTAATCCCACACTGCACTTTGGTTCTTGAGATGATGAATAACAGTCCGATAGCACCACACTCGAGGGATTTTGGCGGTAACAGCAA
CATTCTTGCACAAAAGGAACAGAAAATTTGACAAATCATGCACGCCTGCTGCATGTGTACGACGATGTACTCTGAATCTATGGTAC
page-top