Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig74
Contig Information
Length 560 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7j03    rwhok7j03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0925800 [Oryza sativa (japonica cultivar-group)] >gi|20160720|dbj|BAB89662.1| putative ubiquitin conjugating enzyme [Oryza sativa Japonica Group] >gi|20805218|dbj|BAB92885.1| putative ubiquitin conjugating enzyme [Oryza sativa Japonica Group] >gi|113534790|dbj|BAF07173.1| Os01g0925800 [Oryza sativa (japonica cultivar-group)] >gi|125528935|gb|EAY77049.1| hypothetical protein OsI_05005 [Oryza sativa Indica Group] >gi|125573172|gb|EAZ14687.1| hypothetical protein OsJ_004512 [Oryza sativa (japonica cultivar-group)] >gi|215706954|dbj|BAG93414.1| unnamed protein product [Oryza sativa Japonica Group]
Score 372
Evalue 3.28767e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig74
GGCACCCGAATATTAGCAGCCAGAATGGAGCAATTTGCTTGGACATACTGAAAGATCAGTGGAGCCCAGCCCTTACCTTGAAGACGGCATTGCTATCCCT
TCAAGCTCTTCTTTCTGCTCCTGCCCCTGATGATCCTCAGGATGCTGTTGTTGCACAACAGTATCTGCGTGACAAGGCCACATTTGTTAGTACTGCTCGT
TACTGGACCGAGGCATTCGCAAAGAGCGACTCCACTGGCATGGAAGAAAAGGTGCAGAAGCTGGTCGAGATGGGCTTCCCCGAGGACATGGTGAGAAGCG
CCCTGCTGAGTGTGAATGGCGACGAGAACATGGCTCTCGAGAAGCTCTGCTCTGGCTGAAGGCCCTATGTGGCCTATAAGAAGTGTAAATTGCGAGCCCA
TTCATTATGGAACAACGATCCTAGCTAATGCTCCTGTTATGCCATTCCGGTTTGGCCTATAGGAACAATATATATATAGTGGACTGAAACCATGGGACTG
AACTGAAGAGTGCCTATCATAACTAGACGGTTTGTCTAGCTTGTCTTCTCAAAAAAAAAA
page-top