Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig72
Contig Information
Length 1362 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7e07    rwhok7e07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194708158|gb|ACF88163.1| unknown [Zea mays]
Score 1607
Evalue 1.03926e-176
Total Hit Count 296
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig72
AGCGGCGGAGACCAGGCGATGGCGGCGCCGCTGGAGTTCCTGGAGGCGCAGGGCTCGACCCGGCCGGAGCTGGCGGAGTGGTACGCCGCCCTCGCCGACC
TCTACCAGCGGAAGCTCTGGCACCAACTCACCCTCAAGCTCGACCAGTTCCTCGCCCTCGCCGTCGTCCAGGCGGGTGATGCTCTGATTCAGCTGTATAC
TCATTTCATCTCTGATTTCGAGAGCAAGATCAATCTTCTTAAATTTGCTCACTTCGCGGTAGTAGTTTCACGCCAGTATTCAGATAAAGATGCTGGTATA
AGCTATCTCGAAGGCGTAATTTCTAAGCTGCGTGATACCAAGGAATCACGGGTTGAAGAGCCCATTCTGTATGTGAAGATGCAGATTGCAAGTTTTCTTC
TTGAGAAAGGGAATCAAAAGGAGTGTAAGAAACTGATAGATGAGGGGAAAACCACTTTGGATAGCATGGACGATGTTGATCCTTCAGTACATTCCACCTA
TTATTGGTTATGTTCTCAGTACCATAAAGTGTGTCAAGACTATTCTGAATTCTATAAAAATGCTCTTCTCTATCTTGCATACACAACAGTGGAGTCACTT
TCAGAGCCATTCAAACAGAACCTGGCATTTGACCTCTCACTTGCTGCTTTATTGGGTGACAACATATACAACTTCGGGGAGTTGCTTGCCCATCCAATTA
TCCATAGCCTTGTGGGAACACCGGTGGAGTGGATTTATCATATCTTGCAAGCGTTCAACTCTGGCAATCTAGCGTCCTACCAGGAACTCTGCAAAGTTCA
CGCCGCCGCTTTGAGTGCGCAGCCTGCTTTGGTACAGAAGGAGAGGGAACTTCTTGAAAAGATCAATATCCTTTGCTTGATGGAAATCATTTTCAGTCGA
GCATCTCAAGACCGTACAATCCCGTTGAGCACTATAGCTGAACAGACCAGGCTCTCAGTTGAAGATGTGGAGTATCTACTAATGAAGAGCCTCTCTGCTC
ATCTTATCGAAGGCATTATTGATGGGGTCGACGGGACTGTCCATGTTTCATGGGCGCAACCGAGGGTCCTTGGGATCGACCAAGTGAAATCCCTGCGTGA
CCGGCTTGATACCTGGGTCGGGAAGGTGCACACTACTTTGCTGTCTGTCGAAGCCGAAACACCCGACCTGGTAGCTTCGTGATGTTCTTTTGGTCCCCTG
TTGAACGATGGCTGTGACCTTACACAAAGTGAACAGATGGATTTGAAATTTGTATTGATTCTTAGGCTGCAATCTCGCAAAACCTAGAAAGATTTGTTTG
TAAACATGACGATCAGTCTTGTTTTGTTTTGACGTGGAACTCAATGTATGCGCAACGGCTCT
page-top