Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig71
Contig Information
Length 784 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6h19    rwhok6h19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195605816|gb|ACG24738.1| trafficking protein particle complex protein 2 [Zea mays] >gi|195648512|gb|ACG43724.1| trafficking protein particle complex protein 2 [Zea mays]
Score 646
Evalue 1.17765e-65
Total Hit Count 212
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig71
GGCAGGAATTTCGGGCACGAGGGCCGAGGCGCGAGCAGGAAGACGCCGGCGGGCGGCTCCGGCGACCGGAGAATCTGCGGCCTTCCTCCCCGCCCTTTCC
ATAAGATTGCTGCCAGAGTGAAACTAGTCTGTTGGTGGAAATGGCCAGTACAGCATGCTTCGTGATTGTAAGTAAGAACGACATCCCAATCTATGAGGCA
GAAGTTGGATCTGCACCCAAAAAAGAAGATCTGGCTTATCACCATCAGTTCATCCTGCATGCTGCGTTAGATGTTGTTCAGGACCTAGCATGGACCACAA
ATGCAATGTTCCTGAGGTCGGTTGATAGATTTAATGACCTTGTGGTGTCTGTTTATGTAACCGCCGGTCATACTAGATTCATGTTGCTTCACGATTCACG
CAGCGAGGATGGAATAAAAAGCTTTTTTCAAGAGGTCCATGAACTTTACATCAAGATATTCCTCAACCCCCTGTACCTGCCCGGCTCTCGCATCGCATCG
TCACATTTCGACACCAAGGTGAGGGCTCTCGCGAGGAAGTATCTGTAGCGTTTGGCCACGGAGCAGCTTCACTGTCATAACGCGGAAGCAGGGCCAGCAA
ACATCATACTCCACCGCAGCTGTTCTCCCGTCATCTATGCACCCTGCTGAATCAAGTATGCACACTCTTATTTTTCTTCGTGTCGGATCCTTGCGTGCGC
GCCAGTGAATCCCGGGGCTTTCAGAATCGAATTCGGTTTGTAAAATGGGCTGTGCCGCGCGTGGCAAACCTGCACTACCAAACC
page-top