Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig70
Contig Information
Length 614 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10g08    rwhok10g08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194005 [Zea mays] >gi|194694674|gb|ACF81421.1| unknown [Zea mays]
Score 110
Evalue 0.000994757
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig70
GTTAGTACAGGCATTTGGTGGATCATGGGAGTCGAGTTTAACCAGGCGAGCGCGCGGTGGGCGAACAAGAGGTAGAAAGCCCCGCAAAGACCAGCCAGCT
ACCGTAGAGATAGAAGCCAAGGCGAGCCCACCACCCTCAAAACCCGACTCTGTTGGCTTAGAAGCTGATGAAAGGGGCATGGTTAGCTGGGGGCGAACAA
CAAGGCGGTGTCGCAAGCCACGATGCCCATCGGGCAATAGCGTCGCAGCTTCGTCCTGAACAACCTCTGATCCTGGTCGGTTTCGGATTTGCCATCGAGA
TTGCGGTGGACTGGTATAAAGGTAAAAAAAAAAAATCACAGCCATGAGTGTGCATACTCTGCTGGCCTGCTTGGCTGGCCTCCCCCCTCAGAGATTCCAT
GCCTTTTTCGGGTCGAAACATGATGTACATTTTTTTTCTATAATAAATTCTTAAACTAGTCTATATGTGACAATTTCTGTAACAGCGTTGTATTAAGCTG
GGTCCAGGGCCTGAGAGGCCTGCTGTAATTCTTGAGATAGTGGCGAGGTACCTTGACTGGCCGGTACTTGNAAATCAAAAAGGCTAATCGGTGTATTTCT
ATNTAAAAAAAAAA
page-top