Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig69
Contig Information
Length 1278 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6i06    whok15f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0151800 [Oryza sativa (japonica cultivar-group)] >gi|108706222|gb|ABF94017.1| Cell division cycle protein 48, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547458|dbj|BAF10901.1| Os03g0151800 [Oryza sativa (japonica cultivar-group)] >gi|125542437|gb|EAY88576.1| hypothetical protein OsI_10049 [Oryza sativa Indica Group] >gi|125584947|gb|EAZ25611.1| hypothetical protein OsJ_009094 [Oryza sativa (japonica cultivar-group)] >gi|215704352|dbj|BAG93786.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704409|dbj|BAG93843.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704637|dbj|BAG94265.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704711|dbj|BAG94339.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2032
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig69
TACTTCCTATTGATGACACAGGTTGAAGGGATTACAGGAAACTTGTTTGACGCCTTCTTGAAACCATACTTCCTTGAAGCTTACCGTCCTTTGAGAAAGG
GAGACCTTTTCCTTGTGAGGGGTGGAATGAGAAGTGTGGAGTTCAAAGTTATAGAGACTGACCCGGCAGAGTATTGCATTGTTGCACCAGACACTGAGAT
CTTCTGCGATGGTGAACCTGTTAAGAGGGAGGACGAGGAGAGGCTTGACGATGTTGGCTACGATGATGTTGGTGGAGTCAGGAAGCAAATGGCCCAGATC
AGAGAACTGGTTGAACTCCCACTGCGTCACCCTCAACTTTTCAAGTCTATCGGTGTTAAGCCTCCAAAGGGCATATTGCTGTTTGGACCACCTGGCTCCG
GCAAGACCCTTATTGCCAGGGCTGTTGCCAATGAGACGGGTGCATTCTTCTTTCTGATCAATGGCCCAGAAATTATGTCCAAGTTAGCAGGAGAAAGTGA
GAGCAATCTCAGGAAGGCATTTGAAGAAGCAGAGAAGAATGCACCATCAATCATCTTCATTGATGAGATTGATTCAATAGCCCCAAAGAGAGAGAAGACC
AATGGAGAAGTTGAAAGGCGTATTGTGTCTCAGCTGTTGACCCTTATGGATGGGCTTAAGTCCCGTGCGCATGTTATTGTTATGGGTGCTACAAACCGCC
CAAACAGTATTGATCCCGCTCTCAGAAGATTTGGTAGGTTTGATCGTGAGATTGACATTGGAGTCCCTGATGAAGTTGGCCGCCTTGAAGTTCTCAGGAT
TCACACCAAAAACATGAAGTTAGCTGAAGATGTTGAACTGGAACACATTTCTCGAGACACCCATGGGTATGTTGGTGCTGATCTTGCTGCTCTTTGTACT
GAGGCTGCTCTTCAGTGCATTCGTGAGAAGATGGATATTATAGATCTTGAGGATGAGACCATAGATGCTGAGATACTGAATTCTATGGCTGTGACAAACG
ACCATTTCAAGACTGCACTAACGACAAGCAACCCATCTGCTCTCCGTGAAACTGTTGTTGAAGTTCCCAATGTCTCTTGGGAAGATATTGGTGGTCTGGA
GAATGTCAAGCGGGAGTTGCAGGAGACTGTCCAATACCCTGTGGAGCATCCAGAGAAATTCGAGAAGTTTGGCATGTCTCCATCCAAAGGTGTTCTGTTC
TATGGCCCTCCTGGCTGTGGTAAAACCTTGTTGGCCAAGGCAATTGCAAATGANTGCCANGCTAACTTCATCANTATC
page-top