Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig67
Contig Information
Length 799 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7h22    rwhok7h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Oryza sativa (indica cultivar-group)]
Score 701
Evalue 5.16771e-72
Total Hit Count 109
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig67
GTTAAGGAGAAACTGGCTGTGCTAAAGAAAAACGCAGAACCTTACGTGGAGAAGGCGTCGGCAAAATCAGTGGAAGTTTATGAAGCATCCAGGGATGCTA
TTACACCCCACTTTGTAAAATTTAAAGAAGTTTCTGATCCCTACTTCCAGGAAGCTAAGAAGATCTCTAAACCTTACATTGATCAAGTTGCTGAGGTCAC
GAAGCCACATGTTGAGAAAGTTAGGAGTACTCTTAAGCCTTATACTAAAAGAGCAGTTCATGTGTATGGAACATTTCTCGAGTCTGCGACTACATACCAT
CGACAGGCTCAAGCAACCATTTCAGATTACTTGCACCAACATGAAATAACAAAATCACTTGTGACTAAGGAGTTGGTTTGGTTCCTGGCTTCTGCTTTGC
TGGCTCTACCTGTGTTTATTATGTACAGGCTTCTAGTAGAAACCTTCTGCATGAAGAAGCAGAAGAGATCGCCTCGTAATGGTAACGGAAACAATGGCAA
TAGGAGACACAAGCGCCGACATGCTGAGAAGTAAACCATCGTCGGCTGCCATGTAGGGTTGCAGAAATCAGAGCATGCTCTTCCCTGATGAGGCTGTGCT
CTCTTGTCCATGGTAGAAGGATGGAACGCTGTACACCACCAGATTTTTTCGTTTTCCTTTTGCCCCCTATTGTATGGACTATAGTTTCAGCAGCGGCCTT
ATGTATCTGCATCTTGCCGAGGTTTAATATGGGCTTAAACCTCGGCGTTTGTTAATTGTTTATTGTAACTTTGTTAATACGCTTGAGTTTGTTTGCATC
page-top