Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig66
Contig Information
Length 449 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7h21    rwhok7h21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15333 [Oryza sativa Indica Group]
Score 454
Evalue 6.83583e-44
Total Hit Count 149
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig66
AGAGAATCCAAGGAAGGAGCCGGCGGCGATGGCGTGGCGGGCGAGCCTATCCCGGAACGTGAAGGAGATCCGCTTCCTCTTCTGCCAGTCTTCCCCTGCC
AGCGGCCCCGCCCGGGAGTTCGTGAAGAAGAACTACGGTGACATCAAGACCCGCAACCCCACCCTCCCCGTCCTCATCCGCGAGTGCTCCGGCGTCCAGC
CTCAGCTCTGGGCGCGCTACGATATGGGTGTGGAGAGGTGCGTGCGCTTGGATGGCTTGACAGAAGCCCAGATCGACAAGAAGTTGGAGGAGCTAGCCAA
GGCAGGAGTTGCTTAAAGCTAAAAACTGTCAGGCTAGCCAAGTTTTCTTGCGTTAAATCTTCACAAATAAGAGAAAAGTTAACATGGGATGTTACATTAT
CTTGATTTCAGTACCATGACTGTACTCGAGTGTTGAATTAAAAAAAAAA
page-top