Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig64
Contig Information
Length 550 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7h04    rwhok7h04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0234200 [Oryza sativa (japonica cultivar-group)] >gi|303857|dbj|BAA02154.1| ubiquitin/ribosomal polyprotein [Oryza sativa Japonica Group] >gi|13358806|dbj|BAB33149.1| ubiquitin fused to ribosomal protein L40 [Oryza sativa] >gi|13358808|dbj|BAB33150.1| ubiquitin fused to ribosomal protein L40 [Oryza sativa] >gi|52077170|dbj|BAD46215.1| ubiquitin / ribosomal protein CEP52 [Oryza sativa Japonica Group] >gi|108707030|gb|ABF94825.1| ubiquitin fusion protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547950|dbj|BAF11393.1| Os03g0234200 [Oryza sativa (japonica cultivar-group)] >gi|125606687|gb|EAZ45723.1| hypothetical protein OsJ_029206 [Oryza sativa (japonica cultivar-group)] >gi|218202661|gb|EEC85088.1| hypothetical protein OsI_32449 [Oryza sativa Indica Group]
Score 633
Evalue 1.70427e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig64
CCGAGATGCAGATCTTCGTCAAGACCCTGACGGGCAAGACCATCACGCTCGAGGTCGAGAGCAGCGACACCATCGACAATGTCAAGGCCAAGATCCAGGA
CAAGGAGGGGATCCCGCCGGACCAGCAGCGGCTGATCTTCGCCGGGAAGCAGCTGGAGGACGGGCGCACGCTGGCCGACTACAACATCCAGAAGGAGTCG
ACGCTGCACCTCGTGCTCCGCCTCCGCGGGGGCATCATCGAGCCCTCGCTCCAGGCCCTCGCCCGCAAGTACAACCAGGAGAAGATGATCTGCCGCAAGT
GCTACGCCAGGCTGCATCCAAGGGCTGTCAACTGCCGCAAGAAGAAGTGTGGCCACAGCAACCAGCTGAGGCCCAAGAAGAAGATCAAGAACTAGAGCTC
GTAAAACTGTTATTGCCGCTTTCATTGTCTGGATAAATCTGTAGACATAAAATGTTTCTGGGTTATCATTTTGCTGCTCATGTCAGGATGTTGAACCTTG
TTTAACTCTAGATGAGTACTTGGCCTCGTTTTAATATCATAAAAAAAAAA
page-top