Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig62
Contig Information
Length 986 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7g20    rwhok7g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0113I13.6 [Oryza sativa (indica cultivar-group)] >gi|125549639|gb|EAY95461.1| hypothetical protein OsI_17302 [Oryza sativa Indica Group]
Score 834
Evalue 2.77547e-87
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig62
CCTTCTCGTCTCCCACTCCCATGGCGGAAGCCGACGCCCAAACCCAGAGCAACGCGCACTCCTCCTCGCCGCCGGCGGAGGCGTCGGGCGAGCCGATCCC
GGCCGCCCCAGGGTAGGCGCTTCCAAGTGCTGCTTCTCCGACGTTTCCGCTCATGTACCCGATGCTCGTCCCAGGGATGTTCTCCCAGCAGGGTATGGAT
GACCAGGCTCAGGGTCCAGGGATATATGCCATACAGGAGAATCAGTTCATGGGGGCGATGGGAGGTTACGCCCCAAAGACATTCATACCGCTCGCTTACA
ATATACCAACTGAAAGTGTCGGTCCATTGGCTGGAGAGGAGCAAGGACAGGATGCTAGGCAGCAAAATGGCCCTCAAAGACAAGTTGTTGTGAGGAGGTT
TCACTTTGCTTTTCAGCTTGACCTGGCTCTGATCATCAAGTTAGCAGCAGTGGTCTTTTTGTTTAGCCAAGAAGGATCAAAACAAAGGCTGTTTCTTCTC
ATATTGTTTGCGTCCATGATTTACCTATATCAAACTGGAGCGATTACACCTTTCTTAAGATGGCTCCAGCGGGCGGGAGGTGTGGCCGCTCGTCCGCCAC
AGGCTCCTGCTAACCGTGCTCCTCTGGCTGCCCAGAATGATGGCAACGAGCAACCTGGTGGAAACCTCGCAGATCCTGCAAACCCTGACCAAGCCGCGGA
GAACCAGGAACCAGGAGCAGCAGCGGGCAACGAGAACCAGCAAGGTGCAGAGGGAGAAGCAAACCGGCGCAGCTGGCTCGGCGGCATCTTGAAAGAGGTC
CAGCTGGTCGTTGTAGGGTTCGTCGCGTCGCTTCTTCCTGGTTTTCAGCACAATGACTAGGTGAAAGTCTTCCCGTGGCAGAATCGAATATTGGCACCGT
AACTGTTTGTTGTGACATAGGGAGGAAGTACAAGCAGAGGATATATATAAAGCGGGTTCAAATAAGACTTGTTTGCATATGCTGTA
page-top