Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig61
Contig Information
Length 817 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7e05    rwhok7e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ABA-induced protein [Cynodon dactylon]
Score 851
Evalue 2.14056e-89
Total Hit Count 132
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig61
GATCGCAACCGCCCTCTGTCCTCTCCACCTCCTCGCCACCACCTTGGCATCAGTGCCTCTCCCTCCACCCTCTCCCTGCAACTTTTCCCCTCATCTCGTT
GGAATCCATGGCGTCCAAGTCCGCGGTCACCCCAGGTGGGCAGCCCAAGGGCAAGGAGGAGCCCTCCTCCATGGCGGACGTGTACAACCACGAGCTGACG
CCGCTGCAGAAGCACGTCGCCTTCTTCGACCGGAACAAGGACGGCGTCATCCACCCCTCCGAGACCTACGAAGGGTTCCGCGCGATCGGGTGCGGCGTCG
CGCTGTCCGCCTTCAGCGCCGTCTTCATCAACGGACTGCTCGGTCCCAAGACCATACCGGAGAACATGAAGGTTGGAGCTTTCAAGTTTCCGATCTACGT
AAAGAACATCCACAAGGGCAAGCATGGGAGCGATTCGGGCGTGTACGATGCCAATGGAAGGTTTGTTCCTGAAAAGTTTGAAGAGATATTCAAAAAGCAT
GCTCACACCAGGCCTGATGCGCTGACAGGCAAAGAACTGAATGAGTTGCTTCAAGCAAACAGGGAGCCTAACGATTTGAAAGGACGAGTGGGTGGCTTCA
CGGAGTGGAAAGTTCTCTACTCGCTGTGCAAAGATAAGGAGGGATTTCTTCACAAAGAGACCGTCAGGGCAGTCTACGATGGCAGCCTGTTTGTGAAGTT
GGAGCAAGAGAGGAAGCAAGCTAAAGAATATGCCAAGAAGAAATGATGAAAACTATCCCAATACCCCTCTTATTTGTGATTATGCGCAAGTATGCGTAAA
TTATGGTGTGCTTGAGA
page-top