Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig60
Contig Information
Length 883 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6j22    rwhok6j22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Hypothetical protein CBG08000 [Caenorhabditis briggsae]
Score 83
Evalue 2.80154
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig60
CCGTCGACCTTTTGGTTCCCCATCGGACGGATCGGAGTTGGCGAGCGGCGGAGGAAACCCCTAGCCTACATCAGAGAAGAAGACCAGGCGGCTACCGATG
GCGGCGCTTCGAGTCGCGGCGAGGAGGCTCGTCGGCGGTGGCCAGACGCCGGCGGTGGCTGTGGACAAGGCGCAGCGCCGGCTCTTCCCGAGGCTCTCCC
AGGTCGGCCGGGCTAGGTCCACCACATCCTCCGCTGCTGCTGCTGCTGCCGCAGACACCAATGTGGCGGCGACCAAGGGCTGTGAAGATCGGGAGAAACT
CCTGAGAGAGATCCATAACATGAGAGAGGAGCTGTATGACAAGGTTTCGCACGCGGAAAGGACCTACAGTATCCCTGGCAGGGCAGGCAAACATATCAGT
CGGCTGCATGAGGAGCTCGCCGTGCAAGTGGATCCTAGACCCGGGGACAGCACATGGCGCCAGATGCGAGTGCTAAATCCACTTGTTGCGTGCGATTTGC
GACTTTGACCTTCAGCTGGTATGTGCTCATGGGCATGGCCGCTGGTAAGATCGTTGAATTGGATCCAGATGAAAAGCAATGGATCCAGAAGAAAAGAGGG
GAGGCGCGCAAGCAAAGTGAAACAAAATGATTGAGGGCCATGTTTATGAACGGCACAGGTCCAATAAATGGTTGTTACTGTGTTCTTACATGGACGATCA
TCGATCGCTTTGTAGGGCCGATCTAGCTGGTTGGTACCAAGTTGTCTAGATGTTATGATATATCTATTTTAGTGTCTCCCGTTTCTATGTTTGTTGAAGA
TATTGAAATAAGGAGTTCACAGCTCCTGCTGATGTTGCTGCTTAAAGGCTGACATGTAAAAAAAGTTAAGCTGTAGTAGAAGC
page-top