Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig58
Contig Information
Length 708 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6k12    whok18c07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Postia placenta Mad-698-R]
Score 79
Evalue 5.37391
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig58
CGTGCTTGTTTGCAGGCCTGCGACGATGGCGGCTTCCCTTCGCGCGGCGGCGACGAGGATCCTCCGTCCGGCGGGCCAGGGGCTTCGCCGGCTCGTCCAC
ACCCAGGAGCATTCTGGATCCACCCGTGCCTTGGAGGAAGGGTACCCTGCAGCGCAAATCCANCAGCAGAAGGAGGAGCTGTACGATCTCATCGCCGACG
CCTATGCCAATTCCGCGTCTTCCCCTGCTGACAGATATGTGCTCAAGGTTCTCTCCACACAAATCAAGCCGAGACCACGTGACCCTCAGTGGTGTGAGAT
AATTACAATCAAGAAGGCGGGCAACTGGGCTCTGGGAGGTTTTTGTTTTGTTGGTGGTAGCATAATTCTTGCTGGCCTTGCTCAGGGTGTGCGTAAGCGA
GCGGAGCTCGAGATGCCCAAGCCTGTGGAGCCATACAGAATCAAAAGGAAACTGCAGAAGCAAGTCGAGTGACGACGAAATGCATCTTGTTTGATGGAGA
AGCAAGGCCGATATTANTTCTTCTCCAACGCACTCTTATTCANGCCTCTTAAACTATGGCAAATTGTTCGGGTTTATCATTTCTGTAAACTATATATATG
TCTATGATCTGCCACCTATGACTGAGTANTACTATTACTGGATGATCTTTGATCNCATTGTAANATATTTGTGATGTTGCTGACATCNTATGTTGTCCTT
TCTGTTTG
page-top