Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig57
Contig Information
Length 645 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6k15    rwhok6k15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0213800 [Oryza sativa (japonica cultivar-group)] >gi|108706829|gb|ABF94624.1| Mitochondrial carrier protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547837|dbj|BAF11280.1| Os03g0213800 [Oryza sativa (japonica cultivar-group)] >gi|125542892|gb|EAY89031.1| hypothetical protein OsI_10515 [Oryza sativa Indica Group] >gi|125585385|gb|EAZ26049.1| hypothetical protein OsJ_009532 [Oryza sativa (japonica cultivar-group)] >gi|215736969|dbj|BAG95898.1| unnamed protein product [Oryza sativa Japonica Group]
Score 460
Evalue 2.93262e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig57
AACTTACTGTGTATGGGAAGAGGAAGTATTTGCCAGACAGTGATTTACAAGTCAGCAACTCTTTTGAAGGGCTTGTTCTAGGAGGATTATCAGGCGGTTT
TAGTGCATACTTGACAACCCCCTTGGATGTCATCAAGACAAGACTTCAAGTACAAGGATCAACAACTAGGTACAATGGATGGCTGGATGCTATAAAAAAG
ACATGGGATGCTGAGGGAGTGAATGGCTTATTCAAGGGAAGCGTCCCTCGGATAATATGGTATATACCCGCATCTGCATTCACGTTCATGGCGGTGGAAT
TCCTGAGAGAGCATTTCAACGAGAAGGCCGATACAGATGCGGAGACGGCCTTGAACTAGCCTACCTGCTGAGTCTGAGGCTGAGGTGCAAGAGGATTTCT
TGGTTTGTCTGACAGCGGAGTTCCATTTGGCTGATGCAGGAGTAGATATGCATTTTCAGCAATGCAGAAACATATGTAGGTAGAAGAGAGAAGTAGAGCT
GGCTGTCCTTCGTTAAGTCGGAGATTTTTGGGAGTTAGAGACCAGCCGTCTTGGAGCTAGTTGCCTGTACCAATTCCATTTGTAGCCCCTACCATTTGTG
CCACATTGAAGATTCTAAATGCAGTTGCGATCTATAAAAAAAAAA
page-top