Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig54
Contig Information
Length 695 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7f21    rwhok7f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0684000 [Oryza sativa (japonica cultivar-group)] >gi|52076656|dbj|BAD45556.1| putative external rotenone-insensitive NADPH dehydrogenase [Oryza sativa Japonica Group] >gi|113596434|dbj|BAF20308.1| Os06g0684000 [Oryza sativa (japonica cultivar-group)] >gi|218198773|gb|EEC81200.1| hypothetical protein OsI_24219 [Oryza sativa Indica Group]
Score 465
Evalue 8.99495e-45
Total Hit Count 275
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig54
AGAAGGTCCGTTGCGCCTGACGGGGTCAGGGGAGGGGCATCACAATTTCCGCCCATTCCGGTACAAGCATCTTGGGCAATTCGCGCCCTTGGGCGGGGAG
CAAGCCGCGGCAGAGCTCCCGGGCGACTGGGTCTCCATGGGCCACAGCACCCAGTGGCTTTGGTACTCGGTGTACGCAAGCAAGCAGGTGAGCTGGCGCA
CTCGGGTCCTGGTGGTATCCGACTGGACCCGGAGGTTCATATTCGGGAGGGACTCGAGCCGGATCTAGGCACTCGATTCCAGGATGCAATGCAGCAAGAC
CTCTCTGTACAGTACGTATTTGATTGGGCAAATAAGCAAGCAAGGCTGTCTGTCTGTTGATTGTTCCTTCCCTGTCCTGCCAACGGAGCCATCATCCTTC
GTCTGCTGCATGTGAATATGCGATGGTCCTCTTCTCTTCTCTGGATGTGGTTGGTTGTGAATCTGAACTTCTGGAGCGTACCTGGGGCGACGAACTGACC
TAGTGCCCACAGTTCATTGGTAAATGTGCAAAATGCGTGTGAATTTGGTGTACATGGCTCTGTTTTTCTTTTTTCTTGTTTTGAACTGGCTCTGCTGATT
TTCGTTCCATGTTCATTTCATTGTTAGTGGACCCCCTCACATCTTGTGGGGATAATTATAAAGAACAATGTANGTTATTCTCTCCAAAAAAAAAA
page-top