Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig52
Contig Information
Length 809 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6n24    whok9n07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_007545 [Oryza sativa (japonica cultivar-group)]
Score 844
Evalue 3.83709e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig52
CGAGCCGGTTCGATTTCCTCTCTTCGCCTTCCTCCCCTGCCGGCCCCTCCAAACCCTAGGCGCCGCCGGCCAGGAAGTCCATTTACCAGCCATGTTTGGA
CGCATGCCAAGGAAGACCAGCAACAACACCAAGTACTATGAGGTGCTTGGTGTATCCAAGACAGCAACCCCGGATGAGTTGAAGAAAGCTTACCGGAAAG
CTGCTATAAAAAACCATCCTGATAAGGGCGGAGACCCTGAGAAGTTTAAAGAATTGGCACAAGCTTATGATGTTCTCAATGACCCTGAAAAGAGGGAGAT
TTATGACCAATATGGAGAAGATGCAATCAAAGAAGGGATGGGAGGCAGCGGCGGCGCTGATATGCATAGCCCCTTTGACATATTCGAACAGCTATTTGGG
GGTGGCGGTGGCGGCTTTGGAGGGGGTAGCTCGAGAGGACGCAGACAAAAGCGTGGTGAAGATGTGGTGCATACCATGAAGGTTTCGTTAGAAGACTTGT
ACAATGGTGCTACCAAGAAGCTATCTTTATCACGGAATGTTCTTTGTGGAAAATGCAAGGGAAAGGGATCCAAGAGCGGGGCAACGGCTACTTGCAGTGG
TTGTCGTGGTGCAGGAATGAGGATGATAACAAGACAGATCGGACCTGGCATGATCCAACAGATGAATACTGTTTGCCCTGAATGCAGAGGATCAGGTGAG
ATGATAAATGACAAGGATAGATGCCCAAGCTGCANAGGGGAACAAAGTATCCCAGGAGAANAAGGTCTTGGAGGTTCATGTGGANAAGGGAATGCAACAT
GGCCAAAAG
page-top