Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig51
Contig Information
Length 357 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7e13    rwhok7e13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0345900 [Oryza sativa (japonica cultivar-group)] >gi|78708294|gb|ABB47269.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113639006|dbj|BAF26311.1| Os10g0345900 [Oryza sativa (japonica cultivar-group)] >gi|125531550|gb|EAY78115.1| hypothetical protein OsI_33162 [Oryza sativa Indica Group] >gi|125574472|gb|EAZ15756.1| hypothetical protein OsJ_029965 [Oryza sativa (japonica cultivar-group)] >gi|215768027|dbj|BAH00256.1| unnamed protein product [Oryza sativa Japonica Group]
Score 118
Evalue 6.22722e-05
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig51
ATTTCACAGGCCTCGTCGGGTGTGGAATTCAGGAATGGACAAACAGTCCGTCGCAGCTGGTTTTGTGGTGATGCTTGTGCTCTTAGGAAGCAGTATGAGT
GCAGAGATCTGTGAGAAAACAGGCCTTAGATTGGTCATATGCACCAAGTCTAACTGCCAGCGGTTCTGTCATCTGGAGGCAGAGGCAACTCACAGAAAAC
TCGAGCAGTATTGGTGCGGTGGGACGGTCTTCAACGCTTGCTACTGCAAAGTTTGCACCATCCTATAGAACTTGAATAGATGTTTACCATGCCAAGTGCA
CTTGAAGCTTTGATTTAATAATTGGGCACTCTGTATCCTCGAGTCACAAAAAAAAAA
page-top