Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig50
Contig Information
Length 797 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7f13    whok14b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 2 [Zea mays]
Score 1093
Evalue 1.79907e-117
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig50
ATTCTCTCCGGGAGCGCCGCCGCTTCCTCATCCCCCAGACTCTCGCCTCTCGGCTCGGGAGGCGGAAGCGAAACCCCAAGGAACTATATTCCTGCCGTGA
CATTCAAACACAGTCAAGATGGTGAAGTTTACAGCGGAGGAGCTCCGCGGAATCATGGACAAGAAGAACAATATCAGAAACATGTCTGTTATTGCCCATG
TTGATCACGGCAAGTCTACCCTTACGGATTCCCTTGTGGCAGCTGCTGGGATTATTGCCCAGGAAGTTGCTGGTGATGTTCGGATGACCGATACCCGTGC
AGATGAGGCAGAGCGTGGTATCACAATCAAATCCACGGGTATCTCTCTTTTCTATCAGATGACTCCTGAATCACTCGAGATGTACAAGGGCGATCGCGAT
GGGGATGAATACCTGATCAACCTTATTGATTCACCTGGCCACGTTGACTTTTCTTCGGAAGTCACAGCTGCTCTTCGTATCACTGATGGAGCTTTGGTGG
TTGTTGACTGTATTGAGGGTGTCTGTGTGCAGACTGAAACTGTGCTGCGCCAAGCTCTTGGTGAGAGGATTAGGCCAGTCCTTACTGTGAACAAGATGGA
CAGATGCTTCCTTGAGCTTCAGGTGGAAGGTGAGGAAGCATATCAGACTTTCTCCCGTGTTATCGAGAATGCCAATGTCATCATGGCAACATATGAAGAT
GTGCTCCTTGGTGATGTCCAAGTGTACCCTGAAAAGGGGACTGTTGCATTCTCTGCTGGTCTGCATGGGTGGGCTTTCACCCTTACAAACTTTGCTA
page-top