Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig49
Contig Information
Length 683 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6k23    rwhok6k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative MAP4 kinase [Oryza sativa Japonica Group]
Score 331
Evalue 3.02685e-29
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig49
CCAAATCTCGCGACATGTAAAAATGGGCCAAGCCGGAAGAAGCCAGCCGCCGACGAGGGAGTAGCGTGACGCGAGCACGCCCACGAATCCTGACCCTAGC
CCCGAAGGAGGAAAAGGAGGACGAATCCGGTCGTCTCCTCTTCCCTCCAAAACCCTAGCCGCGGCGGAAGCGAGATCTCAGGGACGATGTCGGACTCGGC
GTCGATGGCGGCCGCCACAGAGGCGCGTTTCAGCAACCGCGACCTCATCGGCCGTGGCTCCTTCGGCGACGTCTACAGAGGGTTTGACAAGGAACTCAGC
AAGGAGGTTGCAATAAAAGTTATTGATCTGGAAGAAGCCGAGGATGATATCGAAGATATCCAAAAGGAGATATCTGTTTTATCACAATGCCGGTGTCCAT
ATATAACTGACTATTATGGCTCTTATCTTCATCAAACCAAACTGTGGATAGTAATGGAGTACATGGCTGGTGGTTCTGTTGCTGACCTAGTATGTCCTGT
ATATTCTATATCTTGATGGACACAACACAATACTTGACACCATGTAGATAGTAGATCAAGTGTATTTGATGAATATTCCAGTTCATAGTCAGCGCAAACT
ACTTGGTTCAAATTGTGATGTTCCTGCGACTTCTATTTCCACATGTAGCTTCAAGCTGGCCCTCCTCTGGATGAAAAAAAAAA
page-top