Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig48
Contig Information
Length 1233 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7f08    rwhok7f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit actin-related protein 2/3 complex subunit 3 [Zea mays]
Score 393
Evalue 1.48363e-69
Total Hit Count 161
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig48
AATTCTGGTTTGACGCCATCACATTTTGCCAGCCATACTACATAACTAGCAGAGGAAGCAATACTTGAGATGACAAAACTTTTCTGAAATGAAGCAAAAC
TTTAAGCCTAAAAATGTAAATTTCCATTCTTGATTCTCATACTAATGGAATCCCTTTCTCATTATTGAAGTACAACTTTATCACTTGATTTATTTCAAAA
TCAAATGGCAAAGCTATATGACACTTCCATTTGCACGTCAGACATATAAGCCATATAGTTTTATGGTGCCTTCTGCTTATACTAGCCAAGGTAGTCCAAA
CTGGCGAAAGGTAATAAAGCGACATAAATTTTGTGGTATCAAAGTACTTCAATTAGAGTTACACCTTTAGGGACACCTTTCATGGGTTTAGGCGTTTGAC
AAATGTAATATGGATGGTAGCAAATAACTATCAAATGTGCTCATCGCTTGCTCTAGTTTCCCATACTAGTTTTGTTAGTTCTAGTTGGTCATGGTTAATG
TTAACTAGCGATATGTGAGCACAATATGTATTTCTCCCTTGAGGACAGGTTTATCACTCTAGTTTCACTGACGATGATGGGATCACAAAAGCCTGTGGGT
GTCCTTTGCTTCCACTAAAAACTCATATCAAGGGCCCAGCCCCAGCCTCAGATTCAGATAAAGCAGATATAGTCGATGAAGCGATAACTTTCTTCCGAGC
AAATGTTTTCTTCAAAAACTTCCATGTCAAAAGCCCAGCAGACAAGTTGCTTATCTATCTGACATCTTACATAAATATTGCATTGAAAAAGACTAGAAAG
CTGCCGGACACTAGCTGTTGGAACTAAGGCAATCATTAACCTTGGGTTGGAAAACTGTTCCTGTGCCCGGGGAACCGGGGTTTCCTTTCCCTGGACTTTT
CACTCTTCCCGAGTCCCAGGAGGAAGCAGAATTGTTGAGGAACTATCTCAAGCAGATAAGGGAGGAAACAAGCGGGAGGCTGCTCAACTGTGCATACAGA
GCTAATGGCACTCCAAACAAATGGTGGTTGGCTTTTGCAAAGAGGAAGTTCATGAACCTTGTCATCCTTTAGAGTGTAATTAAGCATTTCAGCAACAGGT
TAGATGTGTTTTTGTATATCCTTATTTCACTCGCACATTTATTTATATGATGATGTAAATAATCTTTCTTCTGAAGTATTGAAGTATAAAATGCCAAAAA
CAGTTTCTTGCAATGTACCTGCTGCTATTGCGG
page-top