Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig44
Contig Information
Length 802 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7d04    rwhok7d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|125601289|gb|EAZ40865.1| hypothetical protein OsJ_024348 [Oryza sativa (japonica cultivar-group)] >gi|215769010|dbj|BAH01239.1| unnamed protein product [Oryza sativa Japonica Group]
Score 832
Evalue 3.3184e-87
Total Hit Count 44
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig44
GGATTGTCGGGGCAAATGGATTCCAGGGCCGCCCTCTTCTGCTTCCTGGCCGTCGCCTCCTCCCTCCTGCACCCCGCCAGATCTGACGGGGACGACAACC
AGCTCCTCAAGGGGATCAACAGCTACAGAGCTTCGCTCAAGGTCCCGGCGCTCACCGAGAACAGCAATGCCGACTGCCTGGCCGAGCAGCTAGCAAAGAA
GTTCAAGGGCCAGGAGTGCACCAACACCACCGGAGCCAACACCGTGCCCGGCACCGAGCCGCAGTTCCCCGACTACCCCCAGTTTCTCGACCGCTGCCAC
CTCAACGCGTCGGTGACCGAGGACGGGCAGGTGATGCCGGCATGCGTGCCCGGCCTTGTGGCCGACATTGTGCTGACCAACTACACCAAGTCCCAGCACA
ACCGGTTCCTCAACGACACCAAGTACTCCGGCATCGGGATCGCCAACGAGGGGGACTGGGTGGTCGTCGTCCTCAGCACCAGCACCGACTCCGGCGACTA
CTCCCCTGCTCCCCCGGGCTCCAACTGGGCTCCGTCGGTCCAGCCGTTCAGCTGGATGATTGTTTCGCTGGTAGGGTTCGTAGTTTTGCTGATGAAGTGA
GAAGATCGGTGTTGTGTTGTTCATCTCGCGTGCTACACCGCTGCAAATGAGTGTGTTGATCTTATGCCCGTGCCAATCATTTCTGTATTATTCAGATTTC
ATTTCTACTTGATCCAGTTGACACCACAGTACAGTAGCATATGCATGCCACGAGGTTTGGGATCAAAACTTTTTCTCTCGCTATTTGCCTTTGACCACAA
TG
page-top