Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig41
Contig Information
Length 1505 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7d02    rwhok7d02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoglycerate kinase 1 [Bigelowiella natans]
Score 732
Evalue 3.0908e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig41
GCGATCGTATACGATCACGGGTCACAGCGCCGCTTCCTTTCCCCAGCTCGCCAACTCCACTCCCATCGCACACCACCTCGCGACTGAAATCACCGCCAGC
CCGACGCCCCGACCGATCTCCGGCCCGGGGAGGGGAGGGAGGAAATGGGGACCAAGAGGAGCGTGGGCACCCTGGGCGAGAAGGACCTCAGCGGGAAGAA
GGTGCTCCTCCGCGCCGACCTGAACGTGCCGCTAGACGACGGCCAGAGGATCGCCGACGACAACCGCATCCGCGCCTCCGTCCCCACCATCAAGTTCCTC
ATGGGGAAGGGCGCCAAGGTCGTCCTGGCCAGCCATCTGGGCCGGCCAAAAGGGGTCACCCCGAAGTACAGCTTGAAGCCTCTTGTTCCACGCCTGTCTG
AGCTTCTTGGAGTGGATGTTGTGATGGCCAACGACTGCATCGGTGAGGAAGTTGAGAAATTAGCTGCTGCTTTACCAGATGGAGGTGTTCTACTTCTAGA
AAATGTGAGATTCTACAAGGAGGAAGAAAAGAATGACCCTGAGTTCGCCAAGAAACTANCATCTGTTGCTGATCTTTATGTAAATGATGCCTTTGGCACT
GCACATANAGCACATGCTTCAACANAGGGAGTTACCAAGTATTTGAGGCCTGCTGTCGCTGGATTTCTTATGCAGAAGGAACTTGACTATCTTGTTGGAG
CTGTTGCCCAACCCGACAAAGCCATTTGCTGCAATTGTTGGTGGATCCAAAGTGTCAACTAAGATTGGGGTGATCGAGTCTCTTTTGTCGAAGGTTGACA
TCCTCATCCTTGGTGGCGGTATGATTTACACATTTTACAAGGCCCAGGGGCATGCTGTCGGAAAATCTCTTGTGGAGGAAGACAAGCTTGAACTGGCAAA
CTCGCTTATTGAGAAGGCCAAGTTGAAGGGGGTCTCTCTTTTGCTTCCCACTGATATTGTAGTAGCTGATAATTTTGCTGCAGATGCTGAGAGCAAGATT
GTTCCTGCCTCTGCTATTCCTGATGCTTGGATGGGTCTTGATATTGGCCCGGATTCTATCAAGAAATTCAGTGAAACTTTGGACACTATCAAGACTGTCA
TCTGGAATGGACCGATGGGAGTTTTCGAATTTGAGAAGTTTGCTGCTGGCACTGATGCAATCGCGAAAAAGTTGGCTGATATCACAGCAAAAGGCGTAAC
AACCATCATTGGCGGTGGCGACTCTGTTGCTGCCGTCGAGAAGGCTGGTTTGGCGAGTAAGATGAGCCACATTTCGACAGGAGGTGGCGCAAGCCTGGAG
CTGTTGGAAGGCAAGACCCTCCCAGGCGTCCTTGCTCTCGACGACGCATAGGCTGGTGGCAAGACCTAGCTTTACGCCACTCTGTTGTTCAGACCCTTGG
TGTACAGATGCGAGTGTATCCTGAAATAGAAGTAGAGGTTTCTCTGAAGGTTTTGTCAGACGAGCAGTACTAAATAAGCTTGACTTCCGTCGCAATGGGA
GCAGA
page-top