Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig40
Contig Information
Length 641 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6o07    rwhok6o07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012801 [Oryza sativa (japonica cultivar-group)]
Score 329
Evalue 4.49194e-29
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig40
GTTTGTTATCCCCATCCTTCTTCTTGGACACCTGTCTGGCTTGATGGACGATGGAACAAAATTGAGCCTCTTAGGAGTGTGGATGTCACTCTTCACTGTG
TTCGCCGCTAGGAAATTCCAGCAGCCCATTAAGGACGACATCGGCGACAAGTCCGTTTTCATATTCAACGCCCTCCCCGAAGAGGAAAAGAAGGCTCTGC
TGCAGAGGCTCGAGGCGCCAACTGAGCAGAAGTTTGAGTAGCTGGTATCATCGAGCAAGCATGACCACGGTAGCTAGTCGATGGACGCCTGTACAGGTGC
CCTCCCGAGGAGGAAGACAAAATTCTGCTAGCGAGGCTTGAGGGCCAGGCTGAGCTATAGTTGTAGCAGGCACAACGCTGATAGATAGCTAGTGGATGGA
TGCCTGCAACAGTAAGTGTATTTATATGGTAGATTTGGAAATCTGAGCATACAGAGATGACAATACAGTAAATGTGATGTAGTCACAGATCTATGAGGTT
GCATGTAAAATTTGCCAGCCGCTGGGGTCGGGAAATTTCATAATTAGAGGCTGCAACCCTGAAACTCTGAAACTGAAGCATCTGTTTCTTCAGTTTCATT
GCTACATTGCCGGTTTGCATCTGTTTTAATGAAAAAAAAAA
page-top