Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig38
Contig Information
Length 1143 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6o08    rwhok6o08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_011838 [Oryza sativa (japonica cultivar-group)]
Score 891
Evalue 1.19314e-154
Total Hit Count 431
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig38
AGTATTATATCAATGATCAACAAGACAGTTGATGAAATTGAAGCTGAGTTGGATCGACTTGGTAGGCCAATTGGAGGTGACGCTGGGGCACAATTGTATA
CGATATTGGACATGTGTCGCGCATTTGACCGTGTTTTTAAAGAGCACTTAGATGGCGGTCGACCAGGTGGAGATCGCATTTATGGTGTCTTTGACCACCA
GTTACCTGCAGCACTGAAAAAGCTTCCTTTCGATAAACATCTTTCGCTGCAAAATGTTCGGAAAGTCATTTCTGAGGCTGACGGTTACCAGCCCCATTTG
ATTGCCCCCTGAGCAAGGGTTATAGAAGGGCTTATAGATAGTTCACTCAGCTACTTTAGGGGCCCCAGCTGAAGCTTCAGTTGATGCGGTCCATTTTGGT
ATTGAAGGAGCTAGTCCGGAGATCGATTGCAGCAACAGAGGAATTAAAGCGTTTCCCAACGCTTCAATCAGATATAGCTGCAGCAGCAAATGAAAGCCTA
GAAAGATTCCGTGAGGATGGCCGAAAGACAGTTATTCGTCTAGTTGACATGGAGGCCAGTTACCTAACCGTAGAGTTCTTCAGGAAACTTCCTACTGAAC
CAGACAAAGGAGCTAACAACAACACTCCGGCCAACGACAGATATCAGGACAACCATCTTAGAAGAATCGGATCGAATGTATCATCTTACATCAACATGGT
TTGCGATACATTGAGGAACACAATTCCGAAAGCCGTTGTGCATTGCCAAGTGAAGGAGGCAAAAAGAAACTTGCTCAACCGTTTCTATGCGCATGTAGGA
AGCAAAGAGAAGAAACAGCTGAGCGCGATGCTGGACGAGGATCCCGCGTTGATGGAGAAGAGGGATTCCCTCGTGAAGAAGCTGGAGCTGTACAAGTCCG
CGAGGAACGAGATCGACTCGGTTGCATGGAAATGATCTGATCTGATCCGATAGAGCGTTTGCGGCTGGAACAGATAGAACATGTGTAGTAGAGATGCTCC
ATTCGTTTTGCATATGCTTTGTACACGGGCTTTGTTGCCGAGTGTTGTTTTGTGGCTACCACCGAGACATGGACAGACACCGTTGCTTCTTTGGCCATCC
TTTGGCCTCCTGTATGATTCGTATCGATATTAATACAGATGAT
page-top