Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig37
Contig Information
Length 1004 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7b09    rwhok7b09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit caffeoyl-CoA O-methyltransferase [Bambusa oldhamii]
Score 1180
Evalue 2.16591e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig37
TCACCCACCCAACCAACCACCTCTGCACGCGCAGCCCAGATCTCGGCCCCTTCCCTTCCTCGGACCAAGCACCAGCAATGGCCACCACGGCAGCCGACGC
CACGGCCGCGGCGCCCAAGGACCAGCCCGCCAACGGTTCCGAGCAGGTCACGCGCCACTCCGAGGTCGGCCACAAGAGCCTGCTCCAGAGCGACGCCCTC
TACCAGTACATCCTGGAGACGAGCGTGTACCCGCGCGAGCACGAGTGCATGAAGGAGCTCCGCGAGATCACCGCCAACCACCCATGGAACCTGATGACGA
CGTCGGCGGACGAGGGCCAGTTCCTCAACATGCTGCTCAAGCTCATCGGCGCCAAGAAGACCATGGAGATCGGCGTCTACACCGGCTACTCCCTCCTCGC
CACCGCGCTCGCCATCCCCGACGACGGCACCATCTTGGCCATGGACATCAACCGCGAGAACTACGAGCTGGGGCTGCCGTGCATCGAGAAGGCCGGCGTG
GCGCACAAGATCGACTTCCGCGAGGGCCCGGCGCTGCCGGTGCTGGACGCGCTGCTGGAGGACGAGGCCAACCACGGCACCTTCGACTTCGTCTTCGTGG
ACGCCGACAAGGACAACTACCTCAACTACCACGAGCGCCTCATGAAGCTCGTCAAGCTCGGCGGCCTCCTCGGCTACGACAACACGCTCTGGAACGGCTC
CGTCGTGCTCCCCGCCGACGCCCCCATGCGCAAGTACATCCGCTACTACCGCGACTTCGTCCTCGACCTCAACAAGGCCCTCGCCGCCGACCAGCGCGTC
GAGATCTGCCAGCTCCCCGTCGGCGACGGCATCACCCTCTGCCGCCGCGCCAAGTGAACCACAGAACCCGTCTCCGCCGCTCCGCCATAGACGCCAAGAA
CAAGAATTAATTAATTACTCCCCATTTTGTCTTTCCTGCTCGCCTTCTGTACTCTATATNTATCTTCTGCAATTCGTATAAAGATTTCTCCAGACAAACG
ATAA
page-top