Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig36
Contig Information
Length 472 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok10f23    rwhok10f23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195638682|gb|ACG38809.1| hypothetical protein [Zea mays]
Score 95
Evalue 0.0289408
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig36
AAGAAAAGCCATAGAATTTCAGAAGCCAAGGAGAGATCAACCAACAATGCTGACACTTCTTGAATTGGGGATCTGGATCCTCCCGGTGACGCGCATCTTC
ACGCCATGCAGGCGCCTAGTTCTCCTACTTGACAACCTCCAGCAGCTGAAGGAGAGCATCATGCGCACAAGGTCGTCGTCTCCAGCCATTTGGAGTCGCC
TGGCGAGGCTGCAGACGATAACCGTCACATTGTGAAGGAAACCCGGGACTTGATCCTCAGCTGGAGATGTTCGAAACACCAATTTCATCAGGTGGGCGGC
CCTTGCTAGCATTTCCTTGCCTCTGGAGTGGGGTGAATAACTCATCTTGTCCATAAATAGTCTGTTTTTTAGCTTTCTCTTGAAACCAAATGTATTGTCC
CTCGCTGCATGTAAGATGGAGATAAACAAAGAAAGCAAGTGACACTACTCTCTTGTGCATTTAAAAAAAAAA
page-top