Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig35
Contig Information
Length 941 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7e01    rwhok7e01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0180900 [Oryza sativa (japonica cultivar-group)] >gi|34393487|dbj|BAC83047.1| putative 60S ribosomal protein L4/L1 [Oryza sativa Japonica Group] >gi|113610577|dbj|BAF20955.1| Os07g0180900 [Oryza sativa (japonica cultivar-group)] >gi|125599330|gb|EAZ38906.1| hypothetical protein OsJ_022389 [Oryza sativa (japonica cultivar-group)] >gi|215686382|dbj|BAG87643.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737561|dbj|BAG96691.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737607|dbj|BAG96737.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737716|dbj|BAG96846.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765851|dbj|BAG87548.1| unnamed protein product [Oryza sativa Japonica Group]
Score 806
Evalue 4.51841e-84
Total Hit Count 352
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig35
AGCAGCTGGGCGCCTACGCCGACGCCGAGAAGGCCAAGGAGTCCGTCGGCATCCGCCCCGGCAAGGGTAAGATGCGCAACCGCAGGTACATCAACCGCAA
GGGGCCCCTCATCGTCTACGGGCACCGAGGGCTCCAAGATCGTCAAGGCCTTCCGCAACCTCCCCGGTGTGGATGTTGCCAACGTCGAGCGCCTCAACCT
GCTCGACCTTGCCCCTGGTGGCCACCTCGGCCGGTTTGTGATCTGGACCGAGTCTGCCTTCAAGAAGCTGGACGAGGTGTACGGCTCCTTTGAGGCGTCT
TCCTCAAAGAAGAAGGGCTTCGTTCTCCCCAGGCCCAAGATGACCAATGCTGACCTTGGCCGCCTCATCAACTCTGATGAGGTCCAGTCTGTGGTGAAGC
CCATCAACAAGGAGGTCAAGCGCAGGGAGGCCAGGAAGAACCCTCTGAAGAATGCTGCTGCCGTGCTCAAGCTCAACCCCTACTTTGGAACTGCCCGCAG
GATGGCGGTTCTTGCTGAGGCAGCCCGTGTCAAGGCCAGGAAGGAAAAGATCAACTCCAAGAGGACCAAGCTCAGCGCGGAGGAGGCATCTAAGATCAAG
GCTGCAGGGAAGGCCTGGTACCAGACCATGATCTCTGACAGCGACTACACTGAGTTCGACGTCTTCTCCAAGTGGCTCGGCGTCAGCCAGTGATCGTCTA
GTTGAAGTAGTAGCAGTCTATCGTCCTACCTTAAGAGACCCTAAAGTATGATCTTGTGTCATGTTATCGTTTATCCGGAGTCTGAGACATCTTATGCTGT
TTTGGCAGCTGTTTATCTCGAGTGTTTTATCTATGGACGCATTTTGGGAGACATGTTATATGGCATGCTTTATCGTCGTCGAGTTCTTAGTTCAGATTTT
GAGTCGTGTTTTTCATATATACTTTGTTATGAATGCGAAAT
page-top