Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig34
Contig Information
Length 956 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6n18    rwhok6n18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MADS-box protein [Triticum aestivum]
Score 1294
Evalue 1.20277e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig34
GAGTCAGCCATGGGGAGGGGGAGGGTGGAGCTGAAGCGGATCGAGAACAAGATCAACCGCCAGGTCACCTTCGCCAAGCGCAGGAACGGCCTGCTCAAGA
AGGCCTACGAGCTCTCCGTGCTGTGCGACGCCGAGGTCGCGCTCATCGTCTTCTCCAACCGCGGCAAGCTCTACGAGTTCTGCAGCACCCAGAGCATGAC
GAAGACACTCGACAAGTATCAAAAATGCAGTTATGCAGGACCTGAAACTACTGTGCAGAACCGAGAAAATGAGCAACTGAAAAACAGCCGCAATGAGTAC
CTGAAACTAAAGGCACGGGTTGATAATTTACAGCGAACACAAAGGAATTTGCTTGGTGAAGATCTTGATTCATTAGGCATAAAAGAGCTCGAGAGCCTTG
AGAAGCAACTCGATTCATCCTTGAAGCACATTCGAACAACAAGGACACAACATATGGTTGACCAATTGACAGAACTCCAGAGAAGGGAACAAATGTTTTC
AGAGGCGAATAAATGTCTTCGAATAAAATTGGAGGAGAGCAACCAGGTTCATGGGCAGCAGCTCTGGGAGCACAACAACAATGTACTGGGCTATGAACGT
CAGCCGGAAGTGCAGCCGCCGATGCACGGCGGCAATGGATTTTTCCACCCCCTTGATGCTGCTGGTGAACCCACACTTCACATAGGGTACCCTCCTGAGT
CCATGAGTAACTCATGCATGACAACTTTCATGCCCCCGTGGTTGCCTTGATTGAAGACGGCGAAGAAAGTGCGAAGAATAAGTATATACGTGGCACCCGG
CCGGCCGCATATATGCATGTATACTACTTCGAGTGATGGATTATTCCAGTCAAGATCCTCAATTATTTTGCGTGCAACTTTTGTGTGATGAAAACTTCAG
AACCCTGTATTTGATGCTCAACATTATTGTGTTACTGCATGTAAAAGATCATACAT
page-top