Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig31
Contig Information
Length 692 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7d17    rwhok7d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37900 [Oryza sativa Indica Group]
Score 732
Evalue 9.89946e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig31
CACGGGATCGGGCGCATCGACATGGTGGAGAACCGCCTGGTGGGGATGAAGTCCCGCGGCGTCTACGAGACCCCCGGCGGCACCATCATGGCGGCCGCGG
TCCGTGAGCTCGAGTCACTGACGCTAGACAGGGAGACGATGCAGTGGAAGGACATGCTGGCCCTCAAGTACGCGGAGCTCGTCTACGCGGGGCGCTGGTT
CGACCCGCTCCGGCTGTCCATGGACGCCTTCATGGAGACCATCACCGCGACGACGACCGGCTCGGTGACCCTGAAGCTGTACAAGGGGTCGGTGACGGTC
GCGTCCCGGAAGAGCCCCTACAGCCTGTACAGGGAGGACATCTCGTCGTTCGAGAACGGGGAGATCTACGACCAGGCTGACGCGGAAGGTTTCATCAGGC
TGTACGGCCTCCCCACCCGGGTCCGCGCGATGCTGGAGAAGGGAATCTGAAGGTCGGCTTTGCGTCTCGAATAAATTGTTTTCTCATTGAAAACTGCCGA
GTGTGTCTTTGAGTAGCTGTGAACAAATGGAAGAGATTTCCAGGTGGGTGGGCTTTGAGCACATTGTGGAGTTTTCTGTTTTGTTTGGTAGCCTTTTCAT
CCGGTGTGCCTGGATATATGTATTGAGGAGTTGCTCCAACTTGCCGTAATATACTGTTTGGTGCTGCCGTGCATTCCCTTGTCTATTTACTT
page-top