Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig30
Contig Information
Length 1061 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7d16    rwhok7d16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative Zn transporter [Hordeum vulgare]
Score 869
Evalue 1.64816e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig30
TTTGCTGGTATCAGCTTTTGGTTTGTTTGTTAACATCATAATGGCAGTGTTGCTTGGTCATGACCATGGGCACGGTGGACATGGGCACAGCCATGGTCAT
GGCCATGGACATTCACATGACCACGATCATGGTAACTCAGAGGATGACCATTCCCATCATGGAGATCATGAGCAGGGCCCATGTACATCACCATGAGCAC
AGCCCATGGTACTTCTATTACTGTTACAACTAATCATCACTCTCATTCAAGCACTGGACAACATCAGGATGTTGAGCAACCATTGCTTAAACATGATGGA
GATTGTGAGAGTGCCCAGTCTGGAGCCAAGCCTGCCAAGAAGCCTCGCCGTAACATCAATGTTCACAGTGCCTATCTGCATGTAATTGGGGACTCCATCC
AGAGCATCGGTGTAATGATTGGAGGGGCTCTCATCTGGTACAAGCCCGAATGGAAGATTATTGATCTCATATGCACCCTCATCTTCTCTGTGATTGTACT
GTTCACCACAATCAGGATGATTCGGAACATACTGGAAGTTCTTATGGAGAGCACGCCCCGTGAGATCGATGCCACCAGGCTTGAGAGTGGTCTCCGTGAG
ATGGAAGGTGTGATTGCGGTCCATGAGCTGCACATCTGGGCTATCACAGTGGGGAAGGTGCTCTTGGCATGCCATGTGACGATCACGCAGGATGCGGATG
CTGATAAAATGCTTGACAAGGTCATTGGGTACATCAAGGCAGAGTACAACATCAGTCATGTGACCATTCAGATTGAGCGAGAGTAAGGCACATGTCAGGT
AGTTGAGGATAAAGGTGTGCCTGTTAGTGGTTGATCATCTTAAAATGCGGTTAATGTTAGATTTGCACTTGCAAAGGCGTTGCAGGTTCATCTAGCTGTT
GCCTCTGGTGCTGGAGAAATATTATATGTATGCGTTTCCATTAGCCCATTAGTTAAATGAACTATTAAACGGGTGGTGTAGTCGTTTATATTCACATGGA
TGCAATTTTCAGACAGTTTTTGAGCCTTGTGAGTTTATCAACCTGCACGTGTAGTTCAGCG
page-top