Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig27
Contig Information
Length 554 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7a06    rwhok7a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit deleted in split hand/splt foot protein 1 [Zea mays] >gi|195629800|gb|ACG36541.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195652413|gb|ACG45674.1| deleted in split hand/splt foot protein 1 [Zea mays] >gi|195653029|gb|ACG45982.1| deleted in split hand/splt foot protein 1 [Zea mays]
Score 125
Evalue 1.39059e-05
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig27
CCCCCACAATCCCCAGCACGCACGCGCGCACGAACTAATCCGGATCTCTCTGCTAACCCTCTGATCTACTCGGCCGCGTCGCAGCTAGATACTAGCACCA
GCATCGATGGCGGCGGCAGCGCCGGCGGACGCGAAGGCGGAGGCCGCCAAGATGGACCTCCTCGAGGACGACGACGAGTTCGAGGAGTTCGAGATCGACC
AAGAATGGGATGACAAGGAAGATGGCAACGAAGCTGTCCAGCAATGGGAGGATGACTGGGATGATGACGACGTGAACGATGATTTCTCACTGCAGCTGAG
GAAAGAGCTGGAGGGAGGCAACACTCAGAAGAGCTGAACTACTTCGATCAGGCACTGTGTGGCCATTGCTCTCTGAACCTGTGATACTTCCCTAGCAATA
TCAAGCTCTGATACTTATCTTCGTTTCAGCACTGTGTATCAGACTTTGTACCTTACTGCATGTAGTTATCGGCTGCGAGCAGCATAACTTGCCGAACAAT
GATAGTTCCCAGAGAGTATCGCAATTACCCAAAAGTTTGTGGACAAAAAAAAAA
page-top