Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig26
Contig Information
Length 1214 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7d05    rwhok7d05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27383 [Oryza sativa Indica Group]
Score 1101
Evalue 4.16582e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig26
ACCACCACGATCTAGGGTTAATCTGGCCACCAACCCCCACTCCCACCCCAGCATCCTCTCGCCTCGCCCCGCCGTCTCCGACCCCCACCCAGCCGTCCTA
GCAACCCGTTGCAACTCCGCAAGCCATGGAGAAGGCGTCGCACGTGGCCACCGCCGACGGGAAGCAGGCATCGCACAGGATTGCGGTGGTCACTGGTGGA
AACAAGGGAGTCGGCCTGGAGGTGTGCCGGCAGCTTGCTGTCCAAGGTGTGACTGTCATTCTCACAGCCAGGGACGAGAAGAGAGGGAAGGATGCCGTCG
AGTCAATTTGCCTTGAATCCAACCTCTCCAATGTTGTCTTCCACCAGCTCGACGTCCGGGATGACAGCAGCGTCGCCGCTCTAGCGCGACACATCGAGAG
CAGATACGGAGAGCTTGACATCTTGGTTAACAATGCAGCGGTTGTGGGAGTTGCAGCAGACGAGGAAGGCCTCAAAGCTCTGAACCTTGATGCAGAGACA
TGGACATCTGGCAGAGCAGCCACTCTGCTCAAAGACGTGTTCCAGAATACCTATGAGGTGGCACGGGACTGTCTCGACACCAATTACTATGGATGCAAAC
GGGTTACAGAAGCCCTCCTCCCTCTACTGAAACTATCAAAGTTTGGAGCGAGGATTGTCAATGTCTCCTCCCTTGCGTCAGAGCTGAAGAGAATGCCGAA
CGAGGAGCTACGGAAGGACCTGAGCAACATCGACATCTGGGACGAGGCGCGGATCGAGGCGGTGCTCAACACCTTCATGGATGACCTGAAGAATGGACGG
CTGGAGGAGGCGGGGTGGCCGGCGATGCTGCCGGCTTACAGCGTGTCGAAGATGGTGATCAACCTCTACACGAGGATCCTGGCGAGGCGGCACCCGGAGA
TGCGCGTCAACTGCGTGCGTCCTGGCTTCGTCAGGACCGACATCAACTGGAACCTGGGGACCCTGACGCCGGAGCAGGGCGCGAGGGGCCCGGTCATGCT
GTCCCTGCTCCCTCAGGACGGGCCGACCGGGTGCTACTTCGATCAGACGGAGATGGTGAATGTTTGGTAGTGGTTGTTCACTGGATTGTCTGCAGCTACG
TTATGGTAAGTTCATCTTTCTGCGTCATGCCTGAGGCCATTGGCCAGGACAGTTTTCTCTTCTTGCATTTTCGACATGAATAAAAAGTTCAAGACCAGCT
ATGGTCCTGCATAG
page-top