Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig25
Contig Information
Length 600 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6p07    rwhok6p07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small nuclear ribonucleoprotein E [Zea mays] >gi|195611048|gb|ACG27354.1| small nuclear ribonucleoprotein E [Zea mays]
Score 423
Evalue 4.80289e-40
Total Hit Count 489
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig25
GGTTTTTACCTCCCCGCTCCGCCTGCCCCCACGCGCTTCCCTCCAGAAGCTTCTAGACACTTCCAGTCGGAGGAGGAGCTCACGCCGCAGTAGCAGCCAT
GGCGTCCACCAAGGTTCAGCGTATCATGACCCAGCCCATCAACCTCATCTTTCGGTTCCTCCAGAGCAAAGCGCGCATCCAGATCTGGCTTTTCGAGCAG
AAGGATATGCGGATCGAGGGTCGTATCATCGGCTTTGATGAGTACATGAACCTGGTTCTCGAGGATGCTGAGGAAATCAACATTAAGAAGAACACCAGGA
AATCATTGGGAAGGATACTCTTGAAAGGCGACAACATAACTCTGATGATGAACACTGGAAAGTGAAGCTTCTCTCTCTAGGATGGCTGGCGTTGTCGTTC
CTGTGTTGAGCATTCCTGTGATACTTTGTGCTCCACCCAGGCTGACATGCATGTAGCTTGTCGTTGTGGTCACTGAGGATATGTAACGTCTGTTGTCTAT
CTATGAACCCAGACCCAGTAAATCCATTCTGTCGACTCCATGCAAGATGTTTGATCAAGATGATGAGCTTATCGGTTGTGTTTAATTGACAAAAAAAAAA
page-top