Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig24
Contig Information
Length 588 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7c07    rwhok7c07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195610344|gb|ACG27002.1| hypothetical protein [Zea mays] >gi|195639844|gb|ACG39390.1| hypothetical protein [Zea mays]
Score 278
Evalue 2.95141e-23
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig24
CATCGATACACAATCACAGCCTCATCATCAGCCACAAGGGACCCGTACGCATCTCGTTTGCCAGCCTCTTTGGTTGACTGGTTGATCGATCGACCCCTCG
CCGCCGGTGACCATGATGGAGGTGGCCCTCATCTCGCCGGAGCTCCGCGACGTGCTGATCAAGGTGGCCGTGTTCCTGCTCGTGCAGGGGCTGGTGTACC
TCATCCTCACCAACTCCTCCGACGTCTTCTCCAAGAACAAGAGGCTCAGGTCCCTCAGCTTCCGGCCCATGCGGTCCATGAGCGTGCGGCGTGTCCTGGC
GCCGCTCTCCGACGTCCCCGTCGGCACCGACGACGACTCGCCCTCGCCTTCGCTGTCTTCGTATTCTTCGTGGTCGTGGCGCCGGTGGGGTAGCCGCAAA
GAGGATTGAGCAGCTTGGAGGCTGGAGCGGTTGCTTAGTTCTGACGCCAGATGGGTAGCTATAGTACTAGCGAGCTTGGTAATTCTGAACTGTCCTGGGT
TTGTTATCGTGGTTTGACCGTTTGAGATTTGAGAATGGTATTTGTTAAACTCTCATGTAAATCAGGTTATCTGGGGCCTTGTAGATAT
page-top