Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig23
Contig Information
Length 116 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6p03    whok7o03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit sucrose:sucrose 1-fructosytransferase [Triticum aestivum] >gi|55847605|dbj|BAD72792.1| sucrose:sucrose 1-fructosyltransferase [Triticum aestivum] (no hit)
Score 652
Evalue 1.02936e-66
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig23
AGAGCAATAGCCTATTAGCTCTAGGTGGTTTGCTGCGTCTGCCACAATGAGCGTACTTCTGGGGAAAAGCTGTCTCGAACTTATAAATAAGCATTATTTT
TCCTATAAAAAAAAAA
page-top