Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig21
Contig Information
Length 570 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7c16    rwhok7c16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0115100 [Oryza sativa (japonica cultivar-group)] >gi|7248411|dbj|BAA92734.1| ozone-responsive stress-related protein-like [Oryza sativa Japonica Group] >gi|24413949|dbj|BAC22201.1| ozone-responsive stress-related protein-like [Oryza sativa Japonica Group] >gi|113594649|dbj|BAF18523.1| Os06g0115100 [Oryza sativa (japonica cultivar-group)] >gi|125553802|gb|EAY99407.1| hypothetical protein OsI_21378 [Oryza sativa Indica Group] >gi|125595824|gb|EAZ35604.1| hypothetical protein OsJ_019087 [Oryza sativa (japonica cultivar-group)] >gi|215765208|dbj|BAG86905.1| unnamed protein product [Oryza sativa Japonica Group]
Score 305
Evalue 2.03012e-26
Total Hit Count 45
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig21
CAAGCGCGTGCGTCTCCTCCCTCCATCCCTCTCCCGGCGGCGGCGGCGGCGGCGGGCGAACACCGACCGATCGCGAGCAGCAATGTCAGGCAAGTACATC
ATCGGTTCGCTGGTTGGATCCCTTGGCATTGCATATGTCTCCGACACCATCGTTTCCGACAAGAAGATCTTCGGAGGCACCGTCTGCAAGACGGCGACAG
ACAAGGAGTGGTTTCAGGCCACGGACGCCAAGTTCCAGGCCTGGCCCCGTGTCGCCGGGCCGCCGGTCATCATGAACCCCATCAGCCGCCAGAACTTCAT
CGTGAAGGACCCCTGAATGGGCGGCGGCGCGAGCTCGACCAGCGTTTTGCTCCCACCATGGAGCCAAAGTTTCTTTTCTAGGGTTTTCAAGTTCCTAATA
AAAGTGACTTTAAAGTCAGGGTATACTATTTTGTTTTGCGAATTTCAGTTTCCGTGAGCAACTTTGGAGGGGCTTTACCGCTCGCTCAAACGCCTTTCGA
TGAACTCTGTTCCTTGGTGAAATTTCCCACCAGGCAGTAAAATAACTGCATTGTTGTTTCAAAAAAAAAA
page-top