Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig18
Contig Information
Length 1418 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6p09    rwhok6p09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit csAtPR5 [Triticum aestivum]
Score 393
Evalue 6.43745e-36
Total Hit Count 179
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig18
GCCTAGCAAGACATTCCCCTCCTCGAAATCGAAAAGAGAAGAGAACAGCGGCGGCGGGTGGCGGCGGAAAGACGAGGAGCAGAGAGCCGTGTCCTGAGAT
GGAAGGAGAGGCGGAGATGGAAGGGGAGGCGAGGGGAAAGAGAGGCGGCGGAAAGGTGAGGATCATCGAGGCACCACCCAGGATCTCCATGGAGGCTGTG
AATGGAGCCATGGGGAGCGACGAGTTGCCGGAGAGGATTTCCACTTCAGGAGATACAGAATTAGAGATTGAGCAAGCCAAGGAGATGGGAGAGGAAGCCG
AGGAGAGGGATGAGGTGGCAAAATTGGAGATTGAGGAAGCTGAGGGGATGGAGGAGAAGATGCAGACTGGGATGTTCTTTACTATCTACTGTCGCGCCTT
GGAATCGAATTTGTCCAGGTTGTTTAGCAGTCCCTGCAAAGATGCGACTTCATTGAGTCCTATGCACTTCACACACAGTACAACGGACCGCACCTCTTAT
GCTGAATTCGCCACCAGCACTCTGCAAATATACTCCATTAAAGTCGCAGTAATAAAGGGCACTCCTGAGTTGAAGTGGCCACTGCGTGTGTATGGCATGG
TTGCTGCCCGAGATACCGTGGATCACAATCGCAACATTCTCTTCTTGCGTCAAAGGAATGACTGCCAGATACTCACTCCAGAGAATCCTTTTTTGCAATT
GACTGGCCCGTCTCGTGCAATTGCGGCTATAGATCCTGTTGACTTTGACATTAAACTCAAAGTAAAGGGCAGGATGAAGTCAAAAGATAGAGTGCTCATG
CATCAGACCTCCAAGTACAGCTGTAATGAGGCCATTCTGTTGGATGACTCCTGCAGAATTGTGTTACGGTGTGCGAAACTGGAGAAGACAGTGCAAGCAA
CTATAGTCGGTGTCCGTGTTATTAATTGGAGAAAGAAGAAATGGCCTTTTAGACATGGTGGTCTAGTCATTGCCAAGGCACATTCTAAGCCCGTTAAACC
TCAGAATGAGGTCCTGCTACAAGATCAAGTGATGGATAACATTTCAGATGGTTACTTTCAAGGTGAAGTTAGTTGTGTTGGCGACAGATCTTCGGCGCTG
AAACATGAAGATGAGGTTGTGCTTCAAGGTCAAGTGACAGCTAACAATTGGGATGGTTGTCTTGATCTGTCAAGGCACGTTGTTTCCGTAGAGTTAGATG
GAAAGCTCGAAGTCATCATCCGTGCCCTGTCTTCAAATGGTTTTGTTACTAAACATGGCCATGTCTTCTTTCCAGCCCAGGAAAGCAAAATAAGTCGGGG
CATATGTGATCTTGCCTCCTATAAGGTGGAAGTCGCTGTTGCTTGGTCCCTTCTTGTTCGAGACAAGCAGTTTATCTCGAGGGAGGGATGTATGGATGAT
GACTAGGCGGAACATAAA
page-top