Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig17
Contig Information
Length 611 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok6p10    rwhok6p10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00107 [Oryza sativa Indica Group]
Score 533
Evalue 8.91409e-53
Total Hit Count 103
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig17
GCGGCCTTGGCCGTCGCCAACATGGCCGTCGACGAGCTCCGCACGGGCGCCCAGGTCACGAGGCGTGCTGCGATCCTGCTCATGATGGGCCACGACGGGT
TCACCTCCCCGGAGGTGTGCCTGCACTACCTCTTTGCGTCGAGGAACGTTGAGGACCCGCTGGTCCTCGCCGCGGCCGTGTCCGAGCTGGACGGCGGGGA
GGTGGCCAGCCTGCTGAGGTACCTCGCCAAGTGGGTGGGGAAGTACTCCAGGTTCCCGGAGGCCCAGCCTTGCCCCGAGGCGGTGGAAATCCACAAGCTC
GAGCAGTGCGACAGCGTGCCGTCGCTTGTGGCGGTCGCCAGGGCGATGGGCCTGGTGCTGGACCAGCATTTCTCCCACATCGTGCTGAATGCGGAGCTGC
GGCAGGACCTGTTGGCCGCGGGGGTGATGGCGAAAGAGCTGGCTGCCGAGGCTGAAGCTTCGGGTCCAATCCTCGACTTGCTTCGCCGTATGCCGCAGGC
TGTGTGAGAGATTAAACTGTCTGTTTACTTTTGGCACTACTAGTTCTGATGATTCTGGTGTCTGAGAATTTTGGTTGCAGTGATGAGTTATGTGCTCTAG
CAAATCGTGCC
page-top