Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig16
Contig Information
Length 550 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7c01    rwhok7c01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 1.22426e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig16
GATCCAAATCACACATCAGCTCAAAGGAAGGAAGCCGTCAGCCATGTCCGGCCGCGGCAAGGGAGGGAAGGGCCTCGGCAAGGGCGGCGCCAAGCGCCAC
CGGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGCCGTCTGGCGCGGCGGGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACG
AGGAGACCCGCGGCGTGCTCAAGATCTTCCTGGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGA
CGTCGTATACGCGCTCAAGCGACAGGGCCGCACCCTCTACGGGTTCGGCGGCTAGGCCGCGCCGGTCCGGGCAAGAAGGACCCGTCTCGCACCACCGGAT
TTGTGCTAGTAGCTACGCGTTGTCTGATGGTGGTGTTCATGTCCTCGGTGTAATGGCCGCATCTCGCTGCTGTTTGCCCTGGATTTGTTTGTTGTTTGGA
TGTACTANGATGGAATGGAAATCNCANCATTTTACCCCTGAAAAAAAAAA
page-top