Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig15
Contig Information
Length 799 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7b21    rwhok7b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calcium-binding protein [Zea mays]
Score 188
Evalue 1.58142e-12
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig15
GGTGCTCACGAGTGGCTACGATGATGCCTCATGGCCCCTCCAGACACGCCATATGAAGTCTGCTGGGGAAGTTAAGCTTATCATGCACTTTGATGTCTCA
GCAATGAAGAACAAGATGGCAGGTAAAACTTCTGGCCAGTACGCTCCTTCGCCATACGGTGCCTCCTCAGCTTCGTACCCAGCGCCTTCAGCATATGCTG
CAGCACCCCCGCCGCACCAAGCTTATGGAGCTCCTAGCCATGCACCATATCCCGCGCCTTCTGCGTACTCAACTCCGCCTCCTCAGCAGCCATACCCAAC
TCCACCTCCTCAGCAGCCATACCCGCAGCAGGGAGGTCCTCCTACAAGTCACCCACCACAGCCATATGGGCAACCGTACCCGCCGCAGCCATACGGGCAA
CCGTACCCACCACAACCTTATGGGCAGCAACCGTACCCGCCACAGCCATATGGGCAACCCTACCCACCACCTTCAGCAGCACAATCCCCTTATCCACCTG
CGCCGTACCCTGGAGCTTATCCACCGCGGCCATATTGATACACCCAGCTTCAGTGACCTGACGTGGCGGCACCGAAACGAAGAAATGATAATCAGTTGTG
GCCGCTGAGCTGTTTCAAATGGAGTACAATTCACAAGCCTACTGAAGGTGTGTTAGATAACTGAAACAGCATGTAAATCGTCTCCTTTGCGCTAGTGTTG
CGAACAGCCTAGCAAATCATCAGAAACGTTTACTCTCTCTGGTATGCACTATATAAGTAGCTTGCAGAAGCGCGTGATCAAGTCAGTTCTATATTGTGG
page-top