Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig13
Contig Information
Length 1043 bp
Tissue Seed DPA5
Clones 2 Clones [Download: CSV  ,  FASTA ]
whok7a01    rwhok7a01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0245000 [Oryza sativa (japonica cultivar-group)] >gi|50251803|dbj|BAD27734.1| putative splicing factor 3a [Oryza sativa Japonica Group] >gi|113535949|dbj|BAF08332.1| Os02g0245000 [Oryza sativa (japonica cultivar-group)] >gi|125581463|gb|EAZ22394.1| hypothetical protein OsJ_005877 [Oryza sativa (japonica cultivar-group)]
Score 972
Evalue 3.00585e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig13
ATATTTTTGGAACCACCGCAGGAAGAGGTTTCTAATGCCGTCAAGGCAGAAATTGAAAAGAAAAAGGATGAGCAGCCAAATCAGGTTATTTGGGATGGTC
ATTCTGGGAGCATCGGTTGGACAGCCACTCAGGCAATGTCTGTTGGTGGAGAAGAACAGGGTGATGCCTCAAATGCTCCTGGTCCAGCTCCACTTCCTCG
GCCTGGCATGTCGTTGCCCCGGCCTCCCCAACCACTTTCCTTGGTCAATGTTCCCCGATTTACACCCAATCCAATGCCTTATCATGTCCAACCCCCTCAT
CATATGCAAGGAGTTCCACCACATATGATGCCCAACATGCACCAACCTCTGCCACCAGGTCAACAACACATGATTAGGATGTCAGGTCCCATGGGTCATA
TGCCAAGTAATATCCCTCCACCGCCTCCAGGCCATAATACTCAGTTCATGCCTGGTCCACCACGGTTCGCTATGCCCCCTCCCCCGCACATGCAGAACAT
GCCAGCCATGGTCAACCCCATCGGAATCCCCCAGCCTCCACCACCTTTGCCTCCACAACCACCTGCCGAGGAGCAGCCACCTCTACCTGAGGAACCAGAA
CCTAAGAGGCAGAGAACAGATGATGCTTCTCTGATCCCAGCTGAGCAGTTCCTCGCTCAGCATCCGGGCCCTGCTCGCATCTCAGTTTCTGTGCCCAACC
TTGATGAAGGAAACTTGCGAGGCCAAGTTTTGGAGATCTCTGTCCAATCACTCTCAGACACAGTTGGCAGTCTGAAGGAGCAAATTGCTGGAGAGCTGCA
GCTTCCTGCTAACAAGCAGAAGCTGAGTGTGAGGACTAGTTTCCTCAAGGACAATCTTTCTCTTGCTTATTACAATGTTGGCCCTGGGGTGGTCATCAAT
CTAGCTCTGAGGGAGCGTGGTGGGAGAAAGAAATGAGCTTTTCTTATCTCAGTTTACTCGCAGGACAATGCTTACAACCAAGCTTCAGTGGCTATCATGG
AGATTATTTTTGTTGGTTGCTGCCTTCTGGATTCTTGTATCAT
page-top