Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig10
Contig Information
Length 579 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok15b06   
Homology (BLAST) Top Hit acidic ribosomal protein P2 [Triticum aestivum] >gi|32400824|gb|AAP80644.1|AF475123_1 acidic ribosomal protein P2a-2 [Triticum aestivum]
Score 167
Evalue 2.13825e-10
Total Hit Count 184
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig10
GGGNANCGACTGANNNANNCACACCACCNCCTCCAGATGGAACCGNAGCNAACTTCTCCCTACCATCAGCCAAGAGCTCGGTGATGTCCTTGCCCTTCAC
TTGGGACAGCATGAGTTCCATCTTCTCATTGTCGATTTCACAACCAACTGCAACATAGCATAAAGGTAAGATTAGAAGCTAACAATAGAAAACAAAGGAC
AACACATTACATACAAGTGACCTTTAATAAACATACAATCTCCCTTGTGTCAAAGCTAAGCATATTCTACATTATATCAGTAGAACTTAAGGCATAAAGG
TTGTTTTCATTGGCAAGCCACATTTCAAGTGTAGGTAACTATTGCTAAACACATAATGATAATAATAACCGGTAACATGGTAACATCAACTGTAGGATCC
AAAGATGTCTTTGTCAGTAGAAGAAAACAGCAGGACCAAAACTAATGTAGGGCACCCAGTAAGACAACATTACCAGACTCAAGAATGGATGTCAGGTCCT
CTGCAGAGGGGCTGGCGTTGCCANAGAGGTAAGCAAGCAGATAGGCAGCAATGAACTTCATCTTGGATCGGANAAGGAA
page-top