Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig9
Contig Information
Length 765 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok8l11   
Homology (BLAST) Top Hit polyubiquitin [Elaeagnus umbellata]
Score 1096
Evalue 7.46846e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig9
ATGCAGATCTTTGTGAAGACCCTCACTGGCAAGACCATCACCCTAGAGGTTGAGAGCTCCGACACCATAGACAACGTCAAGGCCAAGATCCAGGACAAGG
AGGGCATTCCCCCGGACCAGCAGCGTCTCATCTTNGCTGGCAAGCAGCTGGAGGATGGCCGTACCCTTGCTGACTACAACATCCANAAGGAGTCCACCCT
CCACCTTGTCCTGCGTCTGCGTGGTGGCATGCAGATCTTCGTGAAGACCCTCACCGGNAAGACCATCACTCTTGAGGTGGAGAGCTCCGACACCATCGAC
AACGTCAAGGCCAAGATCCANGACAAGGAGGGCATTCCTCCGGACCANCAGCGTCTNATCTTCNCTGGCAAGNNGNTTGAGGATGGCCGTACCCTCGCTG
ACTACNANNTCCAGAAGGAGTCCACCCTTCACCTGGTGCTCCGCCTCCGTGGTGGTATGCAGATTTTTGTGAAAACCCTCACCGGCAAGACCATCACCCT
TGAGGTTGAGAGCTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTGATCTTTGCTGGCAAG
CAGCTGGAGGATGGCCGTACCCTCGCCGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGTNCTGCGCCTGCGTGGTGGCATGCAAAATCTTCGGT
GAAGACCCCTCACCNGGGAANAACCATCACTTCTGGGAGGTTGAAGAGCTCCCGACNACCATCGA
page-top