Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig7
Contig Information
Length 645 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok15a04   
Homology (BLAST) Top Hit Os01g0809300 [Oryza sativa (japonica cultivar-group)] >gi|29468122|gb|AAO85403.1|AF364178_1 leucine-rich repeat protein [Oryza sativa] >gi|29468120|gb|AAO85402.1| leucine-rich repeat protein [Oryza sativa] >gi|55297657|dbj|BAD68228.1| leucine-rich repeat protein [Oryza sativa Japonica Group] >gi|113534109|dbj|BAF06492.1| Os01g0809300 [Oryza sativa (japonica cultivar-group)] >gi|215697906|dbj|BAG92148.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708792|dbj|BAG94061.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218189247|gb|EEC71674.1| hypothetical protein OsI_04146 [Oryza sativa Indica Group]
Score 325
Evalue 1.32251e-28
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig7
ATTAGCCTGCCTGCTCTGGCACGCAGCTAAATTAAACTCACTCACGAATACACCGGCGCCGCCCGATTCTCTGGCTGCATGCTAGTAGTAGTAGTACTGC
CAGTTTATTCTTCACTCCGGCGGGCCGCCAACGCCATGCATCGGTCTAGCAGTTGCCGCCCAGCCGTGGGTTGTCGGCGAGGCTGGAATTGATGTTCTTG
AAGGGACCATCTGTCGGAATCGGGCCGCACAGATCGTTGCTTGATAGATTAACACTCGTCTGTTCGGACATCCCATCCAGCTCGCTTGGGATCGGGCCGG
TCAAGCGGTTCTGTTGAAGGTGCAGCTGTTTCAGAGACTTGAGTTTCCCGAGCGATGCGGGTATCTGCCCCGAGAGGCTGTTGTTGTGCAGGTGCATGGA
GTTCAGGTTCTCCAAGTTGCCCAGCTCTTCAGGGATTGTTCCTTGGATATTGGTGTACGAAATCCACAGTTTGGTTAGCTGGTCCAGCTTGCCCAGCTCC
GGCGACAGAGGTCCGGACAGGTTCGCATGGCCGATTGTAATCTCGGTGACGCGGTTGGCCACGCGGTCGCAGGTGACCTGGGTCCACTCNCANGGGTTCA
CCTCCAGGATCCANGAACNCANCGCGNCGTCGGGGTCCTGTANGA
page-top