Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig6
Contig Information
Length 849 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok7n06   
Homology (BLAST) Top Hit hypothetical protein OsI_24195 [Oryza sativa Indica Group]
Score 850
Evalue 3.0185e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig6
ATATTCATATGAATAGAGATGAAATGCATCAGATAGAAGCAAACAAAAGAAAACACAGGATAACTCGCAGCTGCAGACACAATTCAGGGCTCACTTATTT
ATCAAGTTCACCAAAGCTGTTCACAACAGCAGCAATTCTCAAAAACAACCGAACATAACGATGCATCACACTACGGTAGAAACATAGAAACGACCAGGAC
GACAGACACAGGCACCATTCGAGGACATATCAAAGACACAAGACCTGTGAACCCAACCCACAGAGAAGCCGCTCCATTGACAGGCACTTACTGGCCACCA
CGGAGACGGAGCACCAAGTGAAGGGTGGACTCCTTCTGGATGTTATAGTCCGCCAGGGTGCGGCCATCCTCAAGCTGCTTACCAGCGAAGATCAGGCGCT
GCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATTTTCGCCTTCACATTGTCGATGGTGTCAGAGGACTCAACCTCCAGGGTGATGGTCTTGCCGGTGAG
GGTCTTGACAAAGATTTGCATGCCCCCACGAAGGCGGAGCACCAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCCAGGGTGCGGCCATCCTCC
AGCTGCTTGCCAGCAAAGATGAGACGTTGCTGGTCCGGAGGGATGCCTTCCTTGTCCTGGATCTTAGCCTTCACATTGTCAATTGTGTCCGAGGACTCGA
CCTCAAGTGTGATGGTCTTGCCGGTGAGGGTCTTCACAAAAATCTGCATCCCACCCCTGAGCCTGANCACCANGTGAAGGGTGGACTCCTTCTGGATGTT
ATANTCCGCCCANGGNTGCNGGNCATCCTCCNNCTGCTTTACCANCNNA
page-top